RNA id: TCONS_00004861


Basic Information

Item Value
RNA id TCONS_00004861
length 432
RNA type mRNA
GC content 0.53
exon number 3
gene id XLOC_002613
representative False

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 9186651 ~ 9192450 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATAATTTAAGAATCAAAGCTCGGAGCATTCAGGAAAATCAGGAATCACCCCACGACCTGAGAGGAGTTTATTTATGCCGTGGATTAAAATGGGTTCAGAGAAGAGCGCGCGGTGTCTGCTGGACGCGGCGGCCGCTCAGCGTTGGATCACAGAGACTCTGAGCAGCATCAGGACCGCTCGAGCAGTGCGGGCAGGAGCGGTGCTCGGACCCTGTGCCGGAGCTCACAGCATCGCCTTCATTGCCTGCAAGTGCTCGGACAGACGAGCCGCCGCCTGCGTGCTCCAGATCGACCCATCAGAATCCAGTGAATATCTACAGATGGTTCAGTCTGCAAGGAATTCGGAGGAACAAAATCTAGAGGCGTATATGAAGAACGGACATCTCTATTTTAGAGCCATAAAGGACATTCCTGAACACACAGAGCTTTTGGC

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0014003 oligodendrocyte development biological_process
GO:0005634 nucleus cellular_component
GO:0046872 metal ion binding molecular_function
GO:0003676 nucleic acid binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-091204-320 Predicted to enable metal ion binding activity. Predicted to be involved in oligodendrocyte development and regulation of transcription, DNA-templated. Predicted to be active in nucleus.

Ensembl:

ensembl_id ENSDART00000139783

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00006001 lncRNA downstream 43423 9145508 ~ 9146642 (-) True XLOC_002612
TCONS_00006000 lncRNA downstream 331497 8841698 ~ 8858568 (-) True XLOC_002606
TCONS_00005999 lncRNA downstream 331516 8841698 ~ 8858549 (-) False XLOC_002606
TCONS_00005998 lncRNA downstream 532388 8638921 ~ 8657677 (-) True XLOC_002603
TCONS_00004846 lncRNA downstream 568792 8618849 ~ 8621273 (-) True XLOC_002602
TCONS_00004863 lncRNA upstream 72223 9264673 ~ 9269249 (-) False XLOC_002614
TCONS_00004864 lncRNA upstream 72223 9264673 ~ 9269711 (-) True XLOC_002614
TCONS_00005750 lncRNA upstream 73603 9266053 ~ 9267711 (-) True XLOC_002615
TCONS_00004867 lncRNA upstream 342165 9534615 ~ 9536874 (-) False XLOC_002618
TCONS_00004868 lncRNA upstream 342321 9534771 ~ 9537977 (-) False XLOC_002618
TCONS_00004858 mRNA downstream 74682 9105007 ~ 9115383 (-) True XLOC_002610
TCONS_00004854 mRNA downstream 100520 9006574 ~ 9089545 (-) False XLOC_002608
TCONS_00004857 mRNA downstream 103349 9037371 ~ 9086716 (-) True XLOC_002608
TCONS_00004853 mRNA downstream 233092 8955287 ~ 8956973 (-) True XLOC_002607
TCONS_00004852 mRNA downstream 234652 8947348 ~ 8955413 (-) False XLOC_002607
TCONS_00004862 mRNA upstream 55143 9247593 ~ 9269733 (-) False XLOC_002614
TCONS_00004865 mRNA upstream 112600 9305050 ~ 9346360 (-) True XLOC_002616
TCONS_00004866 mRNA upstream 204855 9397305 ~ 9410068 (-) True XLOC_002617
TCONS_00004874 mRNA upstream 642446 9834896 ~ 9961488 (-) False XLOC_002620
TCONS_00004875 mRNA upstream 643229 9835679 ~ 10018794 (-) False XLOC_002620
TCONS_00004859 other downstream 48386 9141565 ~ 9141679 (-) True XLOC_002611
TCONS_00004856 other downstream 100429 9037358 ~ 9089636 (-) False XLOC_002608
TCONS_00004855 other downstream 173228 9016721 ~ 9016837 (-) True XLOC_002609
TCONS_00004848 other downstream 512237 8675890 ~ 8677828 (-) True XLOC_002605
TCONS_00004819 other downstream 1230227 7929771 ~ 7959838 (-) True XLOC_002588
TCONS_00004869 other upstream 342332 9534782 ~ 9538326 (-) False XLOC_002618
TCONS_00004879 other upstream 1126858 10319308 ~ 10332427 (-) False XLOC_002623
TCONS_00004880 other upstream 1137014 10329464 ~ 10329554 (-) True XLOC_002623
TCONS_00004903 other upstream 2568930 11761380 ~ 11764439 (-) True XLOC_002636
TCONS_00004913 other upstream 4112615 13305065 ~ 13305183 (-) True XLOC_002643

Expression Profile

//