RNA id: TCONS_00004869



Basic Information


Item Value
RNA id TCONS_00004869
length 643
RNA type processed_transcript
GC content 0.40
exon number 6
gene id XLOC_002618
representative False

Chromosome Information


Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 9534615 ~ 9538335 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


tcgacatgcaggcaacggctctcctaatttgaaattcacctgtcgtctttcatccagcgaattcatcctcgcacaacactgagatgaaggcgaagtcaccatgaaaagttaaacgtttaccgttaagctacagtaattgatgttgaaaaactgatgcaaccaatcactcctcacttgattattcaagcccagattgtgatggacctggaatgcgaaaccagttactcttaagacaagaaccgaataaagcacagatgtggagggatttgcagccaaactaactggagggaaggaacctttagtgtgggtgaacatactacctggatgtccaacaaaggctgcacaagagctcatttgatagcacacattctgtcctgtctacatctctgatgacctggaagtgcttcgacatcagatcatcagaagtgctgctgccctttttcactgtccctttccacatcatttggccttcatcatttcctgtcttgtagcagtattttcacctgtttttaaaattgtaataatttttgatgcattaattgttgactggttttaatgatcaattgtttattagtgttctgttgctctgttatattgaattattgctactgttttagcatggtttacacaataaacctttatt

Function


GO: NA

KEGG: NA

Ensembl:

ensembl_id ENSDART00000147269

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00004864 lncRNA downstream 265071 9264673 ~ 9269711 (-) True XLOC_002614
TCONS_00004863 lncRNA downstream 265533 9264673 ~ 9269249 (-) False XLOC_002614
TCONS_00005750 lncRNA downstream 267071 9266053 ~ 9267711 (-) True XLOC_002615
TCONS_00006002 lncRNA downstream 343027 9190097 ~ 9191755 (-) True XLOC_002613
TCONS_00006001 lncRNA downstream 388140 9145508 ~ 9146642 (-) True XLOC_002612
TCONS_00006003 lncRNA upstream 108036 9646362 ~ 9661692 (-) True XLOC_002619
TCONS_00004878 lncRNA upstream 377082 9915408 ~ 10016348 (-) True XLOC_002620
TCONS_00006004 lncRNA upstream 723019 10261345 ~ 10288666 (-) False XLOC_002621
TCONS_00006005 lncRNA upstream 735403 10273729 ~ 10278533 (-) True XLOC_002622
TCONS_00006006 lncRNA upstream 749129 10287455 ~ 10288683 (-) True XLOC_002621
TCONS_00004866 mRNA downstream 124714 9397305 ~ 9410068 (-) True XLOC_002617
TCONS_00004865 mRNA downstream 188422 9305050 ~ 9346360 (-) True XLOC_002616
TCONS_00004862 mRNA downstream 265049 9247593 ~ 9269733 (-) False XLOC_002614
TCONS_00004861 mRNA downstream 342332 9190065 ~ 9192450 (-) False XLOC_002613
TCONS_00004860 mRNA downstream 343951 9186651 ~ 9190831 (-) False XLOC_002613
TCONS_00004874 mRNA upstream 296570 9834896 ~ 9961488 (-) False XLOC_002620
TCONS_00004875 mRNA upstream 297353 9835679 ~ 10018794 (-) False XLOC_002620
TCONS_00004876 mRNA upstream 298966 9837292 ~ 10016348 (-) False XLOC_002620
TCONS_00004877 mRNA upstream 346077 9884403 ~ 10018120 (-) False XLOC_002620
TCONS_00004882 mRNA upstream 1026121 10564447 ~ 10607118 (-) True XLOC_002624
TCONS_00004859 other downstream 393103 9141565 ~ 9141679 (-) True XLOC_002611
TCONS_00004856 other downstream 445146 9037358 ~ 9089636 (-) False XLOC_002608
TCONS_00004855 other downstream 517945 9016721 ~ 9016837 (-) True XLOC_002609
TCONS_00004848 other downstream 856954 8675890 ~ 8677828 (-) True XLOC_002605
TCONS_00004819 other downstream 1574944 7929771 ~ 7959838 (-) True XLOC_002588
TCONS_00004879 other upstream 780982 10319308 ~ 10332427 (-) False XLOC_002623
TCONS_00004880 other upstream 791138 10329464 ~ 10329554 (-) True XLOC_002623
TCONS_00004903 other upstream 2223054 11761380 ~ 11764439 (-) True XLOC_002636
TCONS_00004913 other upstream 3766739 13305065 ~ 13305183 (-) True XLOC_002643
TCONS_00004918 other upstream 4068701 13607027 ~ 13607143 (-) True XLOC_002646

Expression Profile


Expression of TCONS_00004869 in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.
//

Expression of TCONS_00004869 in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.