RNA id: TCONS_00004896


Basic Information

Item Value
RNA id TCONS_00004896
length 890
RNA type mRNA
GC content 0.53
exon number 2
gene id XLOC_002632
representative True

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 11324515 ~ 11353469 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAAATGGCGGATCTTTCGAAATCCAAGCCCGGCCTGAAATAGACACGCAGCCCGCTTAACTCCTTTTAACAGGACTCCGTTCTGGAGACAAACATCCCTATCTGCAAAAACTCTTGAATATACGCGTACACATGAATATTTTAATGGCATCAGTATAGACAGGAAAGCAGACGCGTCGAATACCAACAAACTCCGTCAGATGTGAAACTGACAGGCTTGTTTTTAACTGTTGAGTGTGTTTTCGGTAACTCTGCAGAATGGATGTGGTGTCTCCTGAGCTCAACAGCCTCCTCCCTGATGAGATCATGGATACAGAGGCAATGGATGAAGATCCGCCTGCTTCACATCTTACCCCTCCGCCCCAATCTGCCCCAGAGTCGGCGCAGGTACCAATGGAAACAGAGGTGCCTGAAATCATTAGCATTTGTCCAACCACCGCGTCTATGCAGGCCATCTCCACCAATGCTAAAAGTACCACCAGTTCCACAACTCAACTCCTACTCACCCCATCATCATCCTCCTCCACCACTACAAAAAACGCCACTCCGACCCTCCCCAAAATTCCCAGCCTTTCCGTCCCGCCAAACCACCAGCTCATCATCAATAAAGTGGCGGCAGATGGAAAGTCTCCGGGCGGCGCAGTGATAAAGCAGGAGGGCCAGAAACTGCTGGTTGCCGGGCTCAGTAAAACAGGGCAGCCCATTATGCTGGCTCTGCCCCACGCTTGGAACAAGCCGGCCACCAGCCAGGGCTCAGGTGATGCCAAGAGCCAGCCCACGCAGATCAAGATGGTGACGGCGATGGGTAAGCCTGTGATCGCAGTGAGCTCAGCCAGTCAGCTGGTGGCTTCATCCACACCACTGCAGGCACAGCACCTCAAGACACTGCAG

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0007049 cell cycle biological_process
GO:0005634 nucleus cellular_component
GO:0046872 metal ion binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function

KEGG:

id description
ko04218 Cellular senescence

ZFIN:

id description
ZDB-GENE-060929-440 Predicted to enable DNA binding activity and metal ion binding activity. Predicted to be involved in regulation of transcription, DNA-templated. Predicted to be active in nucleus. Orthologous to human LIN54 (lin-54 DREAM MuvB core complex component).

Ensembl:

ensembl_id ENSDART00000135527

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00004895 lncRNA downstream 14388 11331969 ~ 11333113 (-) False XLOC_002632
TCONS_00006010 lncRNA downstream 559852 10784334 ~ 10787649 (-) True XLOC_002626
TCONS_00006009 lncRNA downstream 633274 10712178 ~ 10714227 (-) True XLOC_002625
TCONS_00004883 lncRNA downstream 633280 10712178 ~ 10714221 (-) False XLOC_002625
TCONS_00004881 lncRNA downstream 768669 10564261 ~ 10578832 (-) False XLOC_002624
TCONS_00006011 lncRNA upstream 543840 11895373 ~ 11898575 (-) True XLOC_002638
TCONS_00006012 lncRNA upstream 1947306 13298839 ~ 13301973 (-) True XLOC_002642
TCONS_00006013 lncRNA upstream 3679473 15031006 ~ 15042748 (-) True XLOC_002656
TCONS_00006014 lncRNA upstream 3681439 15032972 ~ 15034960 (-) True XLOC_002657
TCONS_00004942 lncRNA upstream 3730877 15082410 ~ 15084047 (-) False XLOC_002660
TCONS_00004892 mRNA downstream 24367 11319971 ~ 11323134 (-) True XLOC_002631
TCONS_00004889 mRNA downstream 85936 11146321 ~ 11261565 (-) False XLOC_002630
TCONS_00004891 mRNA downstream 86115 11146489 ~ 11261386 (-) True XLOC_002630
TCONS_00004890 mRNA downstream 144337 11146489 ~ 11203164 (-) False XLOC_002630
TCONS_00004888 mRNA downstream 335501 11000894 ~ 11012000 (-) True XLOC_002629
TCONS_00004897 mRNA upstream 20428 11371961 ~ 11376491 (-) False XLOC_002633
TCONS_00004898 mRNA upstream 20895 11372428 ~ 11376010 (-) True XLOC_002633
TCONS_00004899 mRNA upstream 30832 11382365 ~ 11385155 (-) False XLOC_002634
TCONS_00004900 mRNA upstream 31264 11382797 ~ 11383900 (-) True XLOC_002634
TCONS_00004901 mRNA upstream 42995 11394528 ~ 11397590 (-) True XLOC_002635
TCONS_00004879 other downstream 1015074 10319308 ~ 10332427 (-) False XLOC_002623
TCONS_00004880 other downstream 1017947 10329464 ~ 10329554 (-) True XLOC_002623
TCONS_00004869 other downstream 1809175 9534782 ~ 9538326 (-) False XLOC_002618
TCONS_00004859 other downstream 2205822 9141565 ~ 9141679 (-) True XLOC_002611
TCONS_00004856 other downstream 2257865 9037358 ~ 9089636 (-) False XLOC_002608
TCONS_00004903 other upstream 409847 11761380 ~ 11764439 (-) True XLOC_002636
TCONS_00004913 other upstream 1953532 13305065 ~ 13305183 (-) True XLOC_002643
TCONS_00004918 other upstream 2255494 13607027 ~ 13607143 (-) True XLOC_002646
TCONS_00004919 other upstream 2260600 13612133 ~ 13612248 (-) True XLOC_002647
TCONS_00004920 other upstream 2580036 13931569 ~ 13931696 (-) True XLOC_002648

Expression Profile

//