RNA id: TCONS_00051772


Basic Information

Item Value
RNA id TCONS_00051772
length 767
RNA type processed_transcript
GC content 0.54
exon number 2
gene id XLOC_026575
representative False

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 34452336 ~ 34586403 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTTTGATCCTGCAGATTCAGCTTCAAAATGTCTGATTCCACTGTCAATGCGCATTTGGAGGGAATTATCTCAGATTTTGAAGCACTTAAGAGGTCATTTGAAGTGGAGGAGGATACATCCACAAACCCTTCCCCGCTTTCCCGTAGAACAACCAACCCTCTGCGCTCCTCCGGCACTTCATCAAGCAGTCGTTTCCATGACCTGAGATCCCTGAACTCTGAGCCCATGTCCAGGCACGCTTCAGATTCCTCCTCCAACCAGCGCTCTCCAAAGTCCAGCCTGCGCCGTGTGGAGTTATCAGGAGGCCGTGTTCCAGAGACTGTGTCACGTAGGACAGAGATCTCCATTGACATCTCCTCAAAGCAGGTGGACAGCTCGCCCAGTCCTGGCATTGCCCGTTTTGGCTTAAAAAGACCTGAAGTCTCGCTTCAAAGCAAAGCCACAGATGCACCTCTCCACAGAAGGGCTGAAGGTAACCACAGCAGAGCCCAGGAACCCCCAGCACCTCCCAGAAGAGCTGACCCGCCAGTATCTACATCCCGGATCCCTGAGCTGTCCCAAAGGCGAGCAGAGCCTCCCAGCCCTCTTGACATCTCCGCTCCATCTAGACGGGCTGAGATGCACGTTAACAGACAGCTCTCGGACACACAGTCTCCTGCAAGAGAGTCAGAGAACAGCTTCACCTCGGCAGCCAGCATCACTCCTACCTTCAATGAATACAAAACCCCTCCATCAGTGCATGAAGCCCCCATAAGGCCTCTTGAGAG

Function

GO:

id name namespace
GO:0034613 cellular protein localization biological_process
GO:0061640 cytoskeleton-dependent cytokinesis biological_process
GO:0032153 cell division site cellular_component
GO:0015630 microtubule cytoskeleton cellular_component
GO:0031105 septin complex cellular_component
GO:0005940 septin ring cellular_component
GO:0060090 molecular adaptor activity molecular_function
GO:0003924 GTPase activity molecular_function
GO:0005525 GTP binding molecular_function
GO:0000166 nucleotide binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-9187 Predicted to enable GTPase activity and molecular adaptor activity. Predicted to be involved in cellular protein localization and cytoskeleton-dependent cytokinesis. Predicted to be part of septin complex. Predicted to be active in cell division site; microtubule cytoskeleton; and septin ring. Is expressed in several structures, including anterior axial hypoblast; blood vessel; endoderm; mesoderm; and musculature system. Human ortholog(s) of this gene implicated in brachial plexus neuritis. Orthologous to human SEPTIN9 (septin 9).

Ensembl:

ensembl_id ENSDART00000136221

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00051771 lncRNA downstream 48579 34470154 ~ 34477363 (-) False XLOC_026575
TCONS_00051763 lncRNA downstream 345491 34179807 ~ 34180451 (-) True XLOC_026573
TCONS_00051762 lncRNA downstream 345510 34179807 ~ 34180432 (-) False XLOC_026573
TCONS_00053066 lncRNA downstream 384761 34139637 ~ 34141181 (-) True XLOC_026572
TCONS_00051677 lncRNA downstream 587121 33936453 ~ 33938821 (-) True XLOC_026512
TCONS_00051776 lncRNA upstream 45518 34591917 ~ 34593056 (-) True XLOC_026576
TCONS_00052476 lncRNA upstream 94649 34641048 ~ 34641973 (-) True XLOC_026580
TCONS_00052477 lncRNA upstream 107188 34653587 ~ 34655108 (-) True XLOC_026581
TCONS_00051786 lncRNA upstream 154815 34701214 ~ 34706737 (-) False XLOC_026582
TCONS_00051790 lncRNA upstream 221142 34767541 ~ 34778787 (-) True XLOC_026583
TCONS_00051764 mRNA downstream 187973 34258755 ~ 34337969 (-) False XLOC_026574
TCONS_00051767 mRNA downstream 229581 34265049 ~ 34296361 (-) False XLOC_026574
TCONS_00051766 mRNA downstream 229581 34265049 ~ 34296361 (-) True XLOC_026574
TCONS_00051765 mRNA downstream 246833 34265049 ~ 34279109 (-) False XLOC_026574
TCONS_00051760 mRNA downstream 345478 34174004 ~ 34180464 (-) False XLOC_026573
TCONS_00051775 mRNA upstream 41589 34587988 ~ 34593639 (-) False XLOC_026576
TCONS_00051777 mRNA upstream 51342 34597741 ~ 34599662 (-) True XLOC_026577
TCONS_00051778 mRNA upstream 55453 34601852 ~ 34613101 (-) True XLOC_026578
TCONS_00051779 mRNA upstream 77161 34623560 ~ 34624745 (-) True XLOC_026579
TCONS_00051780 mRNA upstream 105745 34652144 ~ 34656745 (-) False XLOC_026581
TCONS_00051752 other downstream 422577 34102957 ~ 34103365 (-) True XLOC_026563
TCONS_00051740 other downstream 439459 34086041 ~ 34086483 (-) True XLOC_026558
TCONS_00051725 other downstream 461006 34063955 ~ 34064936 (-) True XLOC_026547
TCONS_00051722 other downstream 467225 34058679 ~ 34058717 (-) True XLOC_026544
TCONS_00051716 other downstream 477289 34048205 ~ 34048653 (-) True XLOC_026539
TCONS_00051781 other upstream 105911 34652310 ~ 34656737 (-) False XLOC_026581
TCONS_00051782 other upstream 106573 34652972 ~ 34654998 (-) False XLOC_026581
TCONS_00051787 other upstream 197180 34743579 ~ 34753541 (-) True XLOC_026582
TCONS_00051789 other upstream 221142 34767541 ~ 34775954 (-) False XLOC_026583
TCONS_00051794 other upstream 259440 34805839 ~ 34813969 (-) True XLOC_026584

Expression Profile

//