RNA id: TCONS_00051797


Basic Information

Item Value
RNA id TCONS_00051797
length 663
RNA type mRNA
GC content 0.47
exon number 5
gene id XLOC_026586
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 35535121 ~ 35541381 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGGATAGAAAGTCACAGACATGGCGTCCCGTGCGCTTGCACAGTGTGTGCGCTCGCTGGCCCGCGCATCTGCAAGGTTAAATGAAGGCAGAACCGCCTGCGTGCTTCTCGCCGCAGCCCAGCGGCCGCTCTCCTCATGGACCTGCAACCAGAGGACCAGCAGGACTGAACTACTGCGGATTCCCAGCCCGTCTGTTCATCTGTGTCGGCATTACAGTGATGCTCCACCCCTCACATTAGATGACATCCAGGAGCGAGTTCTGTATGTCCTTAAACTCTATGACAAGATCAATCCAGATGTGCTTAAATCGACGTCTCACTTCATGAAAGATCTGGGGCTGGACAGCTTGGACCAGGTGGAGATTATAATGGCCATGGAAGATGAGTTTGGGTTCGAGATCCCAGATGGGGATGGAGAGAAGCTTATGACTCCTGAGGAGATTGTAACATACATTGCAGATAAAAAAGATGTGTATGAATAGAGGTATGGAGGATTGACTCTGTATTAAACAATATGGCTGCAGCATTGAGTTCCAGTTGTACTATCTCCAGTCTCTTGTTTATGGAGTCAACTGCCTTGTCATGTGTACTGTTGTATTTAATGAAAATGTCACTATAAACTTTTTGGGAACTTGAGCTGAAAATAAAGCCAAGACTAAATTGT

Function

GO:

id name namespace
GO:0006629 lipid metabolic process biological_process
GO:0006631 fatty acid metabolic process biological_process
GO:0006633 fatty acid biosynthetic process biological_process
GO:0005747 mitochondrial respiratory chain complex I cellular_component
GO:0005739 mitochondrion cellular_component
GO:0000035 acyl binding molecular_function
GO:0000036 acyl carrier activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-4437 Predicted to enable acyl binding activity and acyl carrier activity. Predicted to act upstream of or within fatty acid biosynthetic process. Predicted to be part of mitochondrial respiratory chain complex I. Predicted to be active in mitochondrion. Orthologous to human NDUFAB1 (NADH:ubiquinone oxidoreductase subunit AB1).

Ensembl:

ensembl_id ENSDART00000183075

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00053068 lncRNA downstream 587919 34947402 ~ 34948061 (-) False XLOC_026585
TCONS_00051793 lncRNA downstream 729901 34801999 ~ 34806079 (-) False XLOC_026584
TCONS_00053067 lncRNA downstream 731262 34801999 ~ 34804718 (-) False XLOC_026584
TCONS_00051790 lncRNA downstream 757193 34767541 ~ 34778787 (-) True XLOC_026583
TCONS_00051786 lncRNA downstream 829243 34701214 ~ 34706737 (-) False XLOC_026582
TCONS_00053069 lncRNA upstream 23750 35565128 ~ 35574451 (-) True XLOC_026588
TCONS_00051803 lncRNA upstream 315752 35857130 ~ 35858160 (-) False XLOC_026591
TCONS_00051804 lncRNA upstream 320998 35862376 ~ 35864621 (-) True XLOC_026591
TCONS_00051807 lncRNA upstream 552262 36093640 ~ 36115291 (-) True XLOC_026592
TCONS_00053070 lncRNA upstream 778861 36320239 ~ 36323625 (-) True XLOC_026600
TCONS_00051791 mRNA downstream 719001 34801146 ~ 34816979 (-) False XLOC_026584
TCONS_00051792 mRNA downstream 719087 34803948 ~ 34816893 (-) False XLOC_026584
TCONS_00051788 mRNA downstream 734939 34766989 ~ 34801041 (-) False XLOC_026583
TCONS_00051784 mRNA downstream 782375 34697278 ~ 34753605 (-) False XLOC_026582
TCONS_00051785 mRNA downstream 811101 34697821 ~ 34724879 (-) False XLOC_026582
TCONS_00051798 mRNA upstream 9492 35550870 ~ 35554809 (-) True XLOC_026587
TCONS_00051799 mRNA upstream 47834 35589212 ~ 35602233 (-) True XLOC_026589
TCONS_00051800 mRNA upstream 91395 35632773 ~ 35801146 (-) False XLOC_026590
TCONS_00051801 mRNA upstream 102108 35643486 ~ 35800221 (-) True XLOC_026590
TCONS_00051802 mRNA upstream 308014 35849392 ~ 35865040 (-) False XLOC_026591
TCONS_00051795 other downstream 587946 34947638 ~ 34948034 (-) True XLOC_026585
TCONS_00051794 other downstream 722011 34805839 ~ 34813969 (-) True XLOC_026584
TCONS_00051789 other downstream 760026 34767541 ~ 34775954 (-) False XLOC_026583
TCONS_00051787 other downstream 782439 34743579 ~ 34753541 (-) True XLOC_026582
TCONS_00051782 other downstream 880982 34652972 ~ 34654998 (-) False XLOC_026581
TCONS_00051816 other upstream 692829 36234207 ~ 36239041 (-) False XLOC_026597
TCONS_00051818 other upstream 698934 36240312 ~ 36246722 (-) False XLOC_026597
TCONS_00051819 other upstream 700290 36241668 ~ 36246795 (-) True XLOC_026597
TCONS_00051846 other upstream 1214655 36756033 ~ 36756149 (-) True XLOC_026612
TCONS_00051856 other upstream 1426493 36967871 ~ 36967993 (-) True XLOC_026618

Expression Profile

//