RNA id: TCONS_00051976



Basic Information


Item Value
RNA id TCONS_00051976
length 690
RNA type mRNA
GC content 0.54
exon number 4
gene id XLOC_026685
representative True

Chromosome Information


Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 41955358 ~ 42086648 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


ATGGCAGCCGTCGTGAATTACTCTCCTCCGTGGTGGGTTAACCTGCTGCACAGACTGCCTCACTTCAATCTCCAATTTGAGCAAACCAGCAGTGATTTTCGCCCAGAGGAGTCGTCATACCAGCAGTCGCTCCTGCTTCTCGGCGGTGTTGCTCTGGCATGCTTGGCTCTGGACCTTCTCTTCCTCCTCATCTACTCCTGCTGGCTGTGCTGCCGCCGGAAGAAGAGCGATGAGCAGCCAAACGCAGACTGTTGCTGCACTGCCTGGTGCGTCATCATCGCCACCCTCGTCTGCAGTGCTGGCATTGCTGTTGGTTTCTATGGGAATGGCGAGACCTGTGACGGCGTCAGTCGGCTTACCTACTCTCTCCGGCATGCCAACCGCACCGTGTCAGGAGTTCACAGACTGGTGTCAGAAAGTACTTCAGCTCAGAGCCAAACTGTGGATGAAAACCTGCGGATACTAAAGGAGCAGTATGCAAAACACACAGACTATTTGTCCATCATACAGAAACTGCAGGATCAGCGGAGCGAGCTGGTTCGTCAGATGGCCGACATCCCCTTTTGGAGCAACCTCGGCGTCTCCCTGGAGGATCTGGCAACCCAGATTGAGCTGTATGACTGGTACAGGTACGTCACGAGAAGCGAGGTATTGGTGAAACACCTGCTTCAAATGTTATCAATCGATTGA

Function


GO:

id name namespace
GO:0006811 ion transport biological_process
GO:0006821 chloride transport biological_process
GO:0034707 chloride channel complex cellular_component
GO:0005886 plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005229 intracellular calcium activated chloride channel activity molecular_function
GO:0005254 chloride channel activity molecular_function
GO:0072320 volume-sensitive chloride channel activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-120508-1 Predicted to enable intracellular calcium activated chloride channel activity and volume-sensitive chloride channel activity. Predicted to act upstream of or within chloride transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be part of chloride channel complex. Predicted to be active in plasma membrane. Orthologous to human TTYH3 (tweety family member 3).

Ensembl:

ensembl_id ENSDART00000187312

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00051968 lncRNA downstream 496599 41531282 ~ 41535761 (-) True XLOC_026682
TCONS_00051965 lncRNA downstream 520150 41396123 ~ 41512210 (-) False XLOC_026681
TCONS_00051966 lncRNA downstream 520150 41445194 ~ 41512210 (-) True XLOC_026681
TCONS_00051957 lncRNA downstream 1069528 40959578 ~ 40962832 (-) True XLOC_026677
TCONS_00053084 lncRNA downstream 1254637 40774418 ~ 40777723 (-) True XLOC_026671
TCONS_00053085 lncRNA upstream 96705 42183353 ~ 42189025 (-) False XLOC_026687
TCONS_00053086 lncRNA upstream 96705 42183353 ~ 42191283 (-) False XLOC_026687
TCONS_00053089 lncRNA upstream 96705 42183353 ~ 42200050 (-) False XLOC_026687
TCONS_00053090 lncRNA upstream 96705 42183353 ~ 42200050 (-) False XLOC_026687
TCONS_00053088 lncRNA upstream 96705 42183353 ~ 42200050 (-) False XLOC_026687
TCONS_00051974 mRNA downstream 15667 41978867 ~ 42016693 (-) False XLOC_026685
TCONS_00051973 mRNA downstream 37039 41967804 ~ 41995321 (-) False XLOC_026685
TCONS_00051970 mRNA downstream 236443 41784542 ~ 41795917 (-) False XLOC_026684
TCONS_00051971 mRNA downstream 241182 41785861 ~ 41791178 (-) True XLOC_026684
TCONS_00051969 mRNA downstream 316670 41629605 ~ 41715690 (-) True XLOC_026683
TCONS_00051977 mRNA upstream 34518 42121166 ~ 42125655 (-) True XLOC_026686
TCONS_00051982 mRNA upstream 831495 42918143 ~ 42968544 (-) False XLOC_026692
TCONS_00051983 mRNA upstream 877397 42964045 ~ 42981739 (-) False XLOC_026693
TCONS_00051984 mRNA upstream 878068 42964716 ~ 42967698 (-) True XLOC_026693
TCONS_00051985 mRNA upstream 1260869 43347517 ~ 43821191 (-) False XLOC_026696
TCONS_00051964 other downstream 720217 41312022 ~ 41312143 (-) True XLOC_026680
TCONS_00051939 other downstream 1502581 40526882 ~ 40529779 (-) False XLOC_026667
TCONS_00051938 other downstream 1502582 40526879 ~ 40529778 (-) False XLOC_026667
TCONS_00051924 other downstream 1873673 40154294 ~ 40158687 (-) True XLOC_026658
TCONS_00051921 other downstream 1943559 40088685 ~ 40088801 (-) True XLOC_026657
TCONS_00051981 other upstream 779435 42866083 ~ 42866200 (-) True XLOC_026691
TCONS_00052007 other upstream 1994975 44081623 ~ 44094226 (-) False XLOC_026707
TCONS_00052055 other upstream 5108489 47195137 ~ 47195234 (-) True XLOC_026732
TCONS_00052070 other upstream 6991114 49077762 ~ 49077879 (-) True XLOC_026748
TCONS_00052082 other upstream 7728549 49815197 ~ 49815287 (-) False XLOC_026760

Expression Profile


//