RNA id: TCONS_00052044


Basic Information

Item Value
RNA id TCONS_00052044
length 530
RNA type mRNA
GC content 0.55
exon number 4
gene id XLOC_026728
representative False

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 46800190 ~ 46818001 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTTTTCGCAGGCCAGAGCTTGGGATATGGCTTTGTAAACTATGTGGATCCCAACGACGCCGACAAGGCTATCAACACGCTCAACGGTCTCAAACTGCAGACCAAAACAATCAAGGTGTCTTACGCCAGGCCCAGCTCAGCTTCCATCCGCGATGCCAACCTGTATGTGAGCGGCCTGCCCAAAACCATGAGTCAGAAAGACATGGAGCAGTTGTTTTCCCAGTATGGAAGGATCATCACCTCACGCATCCTGGTAGACCAGGTCACAGGTATATCGCGCGGGGTAGGTTTCATTCGGTTCGACAAACGGAACGAAGCAGAGGAGGCCATCAAGGGCCTGAACGGTCAGAAGCCACTAGGAGCAGCTGAGCCCATCACCGTAAAGTTCGCCAACAACCCCAGTCAGAAGACAGGACAGGCTCTGCTGACCCAGCTCTACCAGACAGCCGCTCGCCGCTACACTGGCCCTCTGCACCACCAGACCCAGCGCTTCAGATTCTCCCCCATAACCATTGACAGCATGACTAGTCT

Function

GO:

id name namespace
GO:0050767 regulation of neurogenesis biological_process
GO:1990904 ribonucleoprotein complex cellular_component
GO:0003676 nucleic acid binding molecular_function
GO:0003723 RNA binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-980526-76 Predicted to enable RNA binding activity. Acts upstream of or within regulation of neurogenesis. Predicted to be located in viral nucleocapsid. Predicted to be part of ribonucleoprotein complex. Is expressed in several structures, including nervous system; neural plate; neural tube; neuronal stem cell; and presumptive structure. Orthologous to human ELAVL3 (ELAV like RNA binding protein 3).

Ensembl:

ensembl_id ENSDART00000134092

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00052040 lncRNA downstream 40637 46757611 ~ 46762706 (-) True XLOC_026727
TCONS_00053103 lncRNA downstream 340087 46462585 ~ 46463256 (-) True XLOC_026726
TCONS_00052034 lncRNA downstream 576333 46224721 ~ 46227010 (-) False XLOC_026723
TCONS_00053104 lncRNA upstream 318421 47130032 ~ 47131111 (-) True XLOC_026731
TCONS_00052489 lncRNA upstream 383127 47194738 ~ 47196960 (-) False XLOC_026732
TCONS_00053105 lncRNA upstream 1015591 47827202 ~ 47833114 (-) True XLOC_026736
TCONS_00053106 lncRNA upstream 1511929 48323540 ~ 48328133 (-) True XLOC_026738
TCONS_00053108 lncRNA upstream 1649886 48461497 ~ 48469102 (-) False XLOC_026739
TCONS_00052038 mRNA downstream 392956 46387860 ~ 46410387 (-) False XLOC_026725
TCONS_00052039 mRNA downstream 399565 46387865 ~ 46403778 (-) True XLOC_026725
TCONS_00052037 mRNA downstream 423443 46377305 ~ 46379900 (-) True XLOC_026724
TCONS_00052027 mRNA downstream 688111 46043406 ~ 46115232 (-) True XLOC_026721
TCONS_00052025 mRNA downstream 955086 45845007 ~ 45848257 (-) False XLOC_026720
TCONS_00052046 mRNA upstream 107911 46919522 ~ 47036951 (-) False XLOC_026729
TCONS_00052049 mRNA upstream 107911 46919522 ~ 47105267 (-) False XLOC_026729
TCONS_00052048 mRNA upstream 107911 46919522 ~ 47105267 (-) False XLOC_026729
TCONS_00052047 mRNA upstream 107911 46919522 ~ 47105267 (-) False XLOC_026729
TCONS_00052050 mRNA upstream 109026 46920637 ~ 47035746 (-) False XLOC_026729
TCONS_00052007 other downstream 2709117 44081623 ~ 44094226 (-) False XLOC_026707
TCONS_00051981 other downstream 3937143 42866083 ~ 42866200 (-) True XLOC_026691
TCONS_00051964 other downstream 5491200 41312022 ~ 41312143 (-) True XLOC_026680
TCONS_00051939 other downstream 6273564 40526882 ~ 40529779 (-) False XLOC_026667
TCONS_00051938 other downstream 6273565 40526879 ~ 40529778 (-) False XLOC_026667
TCONS_00052055 other upstream 383526 47195137 ~ 47195234 (-) True XLOC_026732
TCONS_00052070 other upstream 2266151 49077762 ~ 49077879 (-) True XLOC_026748
TCONS_00052082 other upstream 3003586 49815197 ~ 49815287 (-) False XLOC_026760
TCONS_00052087 other upstream 3292460 50104071 ~ 50117962 (-) True XLOC_026764
TCONS_00052109 other upstream 4736522 51548133 ~ 51548250 (-) True XLOC_026779

Expression Profile

//