RNA id: TCONS_00052082


Basic Information

Item Value
RNA id TCONS_00052082
length 91
RNA type miRNA
GC content 0.35
exon number 1
gene id XLOC_026760
representative False

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 49757578 ~ 49925313 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGAACAGAATGGAATTTGAAACGTTTTAGCCAAAAATGTTTCCATGGTAAAGGTGTTTTTTGCAGAAACGTTTCAGATTTCGTTCTGTTCT

Function

GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0007188 adenylate cyclase-modulating G protein-coupled receptor signaling pathway biological_process
GO:0007189 adenylate cyclase-activating G protein-coupled receptor signaling pathway biological_process
GO:0010906 regulation of glucose metabolic process biological_process
GO:0007165 signal transduction biological_process
GO:0007166 cell surface receptor signaling pathway biological_process
GO:0005886 plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0017046 peptide hormone binding molecular_function
GO:0016519 gastric inhibitory peptide receptor activity molecular_function
GO:0008528 G protein-coupled peptide receptor activity molecular_function
GO:0004888 transmembrane signaling receptor activity molecular_function
GO:0004930 G protein-coupled receptor activity molecular_function
GO:0004967 glucagon receptor activity molecular_function

KEGG: NA

Ensembl:

ensembl_id ENSDART00000160333

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00052500 lncRNA downstream 25167 49766966 ~ 49790030 (-) False XLOC_026760
TCONS_00053124 lncRNA downstream 396852 49406158 ~ 49418345 (-) True XLOC_026754
TCONS_00053122 lncRNA downstream 442521 49186398 ~ 49372676 (-) False XLOC_026752
TCONS_00053123 lncRNA downstream 443012 49206136 ~ 49372185 (-) True XLOC_026752
TCONS_00053121 lncRNA downstream 626631 49186398 ~ 49188566 (-) False XLOC_026752
TCONS_00053125 lncRNA upstream 105911 49921198 ~ 49925277 (-) True XLOC_026760
TCONS_00053126 lncRNA upstream 119349 49934636 ~ 49937735 (-) True XLOC_026761
TCONS_00052091 lncRNA upstream 312979 50128266 ~ 50139846 (-) False XLOC_026766
TCONS_00052098 lncRNA upstream 457869 50273156 ~ 50277941 (-) True XLOC_026768
TCONS_00053127 lncRNA upstream 523493 50338780 ~ 50341046 (-) True XLOC_026769
TCONS_00052079 mRNA downstream 248833 49559261 ~ 49566364 (-) True XLOC_026759
TCONS_00052078 mRNA downstream 260285 49551580 ~ 49554912 (-) True XLOC_026758
TCONS_00052077 mRNA downstream 300323 49504919 ~ 49514874 (-) True XLOC_026757
TCONS_00052076 mRNA downstream 311174 49459828 ~ 49504023 (-) True XLOC_026756
TCONS_00052075 mRNA downstream 367248 49425793 ~ 49447949 (-) True XLOC_026755
TCONS_00052083 mRNA upstream 217107 50032394 ~ 50046004 (-) True XLOC_026762
TCONS_00052084 mRNA upstream 238900 50054187 ~ 50066528 (-) False XLOC_026763
TCONS_00052085 mRNA upstream 239086 50054373 ~ 50066499 (-) True XLOC_026763
TCONS_00052086 mRNA upstream 261506 50076793 ~ 50118140 (-) False XLOC_026764
TCONS_00052088 mRNA upstream 308220 50123507 ~ 50127668 (-) False XLOC_026765
TCONS_00052070 other downstream 737318 49077762 ~ 49077879 (-) True XLOC_026748
TCONS_00052055 other downstream 2619963 47195137 ~ 47195234 (-) True XLOC_026732
TCONS_00052007 other downstream 5720971 44081623 ~ 44094226 (-) False XLOC_026707
TCONS_00051981 other downstream 6948997 42866083 ~ 42866200 (-) True XLOC_026691
TCONS_00051964 other downstream 8503054 41312022 ~ 41312143 (-) True XLOC_026680
TCONS_00052087 other upstream 288784 50104071 ~ 50117962 (-) True XLOC_026764
TCONS_00052109 other upstream 1732846 51548133 ~ 51548250 (-) True XLOC_026779
TCONS_00052111 other upstream 2092199 51907486 ~ 51907562 (-) True XLOC_026783
TCONS_00052136 other upstream 3874023 53689310 ~ 53689428 (-) True XLOC_026804
TCONS_00052148 other upstream 5247980 55063267 ~ 55079244 (-) True XLOC_026816