RNA id: TCONS_00052087


Basic Information

Item Value
RNA id TCONS_00052087
length 243
RNA type processed_transcript
GC content 0.48
exon number 4
gene id XLOC_026764
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 50076793 ~ 50118140 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GACAGACCGACACGTCGCTTACGATTAGATGACAGATCTGCTAATGCTAACGCTAGCACAACGAGAAAGCCACCAGTCAGCTGCTACTGGAGACTGACTGGGAGTCTATTTTGCAGATCTGTGACCTCATTCGCCAAGGCGATACACAGGCAAAATATGCAATTGGTGCCATCAAGAAAAAACTCAATGACAAAAATCCACATGTGGCACTCTATGCTCTCGAGGTCCTGGAGTCAGTGGTGA

Function

GO:

id name namespace
GO:0006886 intracellular protein transport biological_process
GO:0016310 phosphorylation biological_process
GO:0016740 transferase activity molecular_function
GO:0046872 metal ion binding molecular_function
GO:0016301 kinase activity molecular_function

KEGG:

id description
ko04144 Endocytosis
ko04145 Phagosome
ko04131 Membrane trafficking

ZFIN:

id description
ZDB-GENE-030131-6107 Predicted to enable kinase activity and metal ion binding activity. Predicted to act upstream of or within intracellular protein transport and phosphorylation. Predicted to be located in early endosome membrane. Orthologous to human HGS (hepatocyte growth factor-regulated tyrosine kinase substrate).

Ensembl:

ensembl_id ENSDART00000142009

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00053126 lncRNA downstream 166336 49934636 ~ 49937735 (-) True XLOC_026761
TCONS_00053125 lncRNA downstream 178794 49921198 ~ 49925277 (-) True XLOC_026760
TCONS_00052500 lncRNA downstream 314041 49766966 ~ 49790030 (-) False XLOC_026760
TCONS_00053124 lncRNA downstream 685726 49406158 ~ 49418345 (-) True XLOC_026754
TCONS_00053122 lncRNA downstream 731395 49186398 ~ 49372676 (-) False XLOC_026752
TCONS_00052091 lncRNA upstream 10304 50128266 ~ 50139846 (-) False XLOC_026766
TCONS_00052098 lncRNA upstream 155194 50273156 ~ 50277941 (-) True XLOC_026768
TCONS_00053127 lncRNA upstream 220818 50338780 ~ 50341046 (-) True XLOC_026769
TCONS_00053128 lncRNA upstream 315589 50433551 ~ 50438278 (-) True XLOC_026770
TCONS_00052501 lncRNA upstream 315831 50433793 ~ 50434423 (-) True XLOC_026771
TCONS_00052084 mRNA downstream 37543 50054187 ~ 50066528 (-) False XLOC_026763
TCONS_00052085 mRNA downstream 37572 50054373 ~ 50066499 (-) True XLOC_026763
TCONS_00052083 mRNA downstream 58067 50032394 ~ 50046004 (-) True XLOC_026762
TCONS_00052081 mRNA downstream 178758 49757578 ~ 49925313 (-) False XLOC_026760
TCONS_00052080 mRNA downstream 288848 49757578 ~ 49815223 (-) False XLOC_026760
TCONS_00052088 mRNA upstream 5545 50123507 ~ 50127668 (-) False XLOC_026765
TCONS_00052089 mRNA upstream 5770 50123732 ~ 50124413 (-) True XLOC_026765
TCONS_00052090 mRNA upstream 9764 50127726 ~ 50136424 (-) False XLOC_026766
TCONS_00052092 mRNA upstream 10519 50128481 ~ 50139860 (-) False XLOC_026766
TCONS_00052093 mRNA upstream 10607 50128569 ~ 50147160 (-) False XLOC_026766
TCONS_00052082 other downstream 288784 49815197 ~ 49815287 (-) False XLOC_026760
TCONS_00052070 other downstream 1026192 49077762 ~ 49077879 (-) True XLOC_026748
TCONS_00052055 other downstream 2908837 47195137 ~ 47195234 (-) True XLOC_026732
TCONS_00052007 other downstream 6009845 44081623 ~ 44094226 (-) False XLOC_026707
TCONS_00051981 other downstream 7237871 42866083 ~ 42866200 (-) True XLOC_026691
TCONS_00052109 other upstream 1430171 51548133 ~ 51548250 (-) True XLOC_026779
TCONS_00052111 other upstream 1789524 51907486 ~ 51907562 (-) True XLOC_026783
TCONS_00052136 other upstream 3571348 53689310 ~ 53689428 (-) True XLOC_026804
TCONS_00052148 other upstream 4945305 55063267 ~ 55079244 (-) True XLOC_026816
TCONS_00052166 other upstream 5338391 55456353 ~ 55481157 (-) True XLOC_026827