RNA id: TCONS_00052089


Basic Information

Item Value
RNA id TCONS_00052089
length 682
RNA type mRNA
GC content 0.55
exon number 1
gene id XLOC_026765
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 50123507 ~ 50127668 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TCCAAGTGATCATTCTTGGGAAAGATTCACTATGGCAACCACTGGCATGCAGCTCCTCGGCCTGGTCCTGTCCATCATTGGCCTTGTGGGGGGATTCCTGGTGTGCACCCTGCCCATGTGGAGGGTCACCGCCTTCATCGGGAACAACATTGTAACGGCACAGATCACGTGGGAAGGTCTCTGGATGAATTGCATCTGGCAAAGCACAGGAGAGATTCAGTGCAAGGGGTATGACAGCTTGCTTGCTCTACCCAGTGACATGAAGGCCGCCCGGGGTCTTACGGTTCTCGCTATACTAATCTGCAGTCTTTCGCTCACATTAGGTATTCTGGGTATCAAGTGCACTGAGTGCGTGGGGCTCCCAAGCCTCAAGGCTCGCTTGGCACGTGTGTCAGGTGTGCTCTTTGTCATTGCGGGGTTCCTCATCCTTGTGCCTGTTTGCTGGACGGCCCATTCCATCATCAGGGATTTCTATGACCCCTATGTGGCGGCCCCACACAAACGTGAGCTTGGACCCGCTCTCTACTTGGGCTGGGGGGCTTCGGCTTTACTGTTGATTGGTGGATCGCTTCTCTATGCAGGGTCCAATCCACCCGGGATTCCCTCTTCTCCTACATTTAGCAGTGATGAGAGCAGCCCACGCCGAGCGGGTGGTTCTTCCCAGGTCAAGGGTTATGTTTAA

Function

GO:

id name namespace
GO:0070830 bicellular tight junction assembly biological_process
GO:0007155 cell adhesion biological_process
GO:0005886 plasma membrane cellular_component
GO:0005923 bicellular tight junction cellular_component
GO:0030054 cell junction cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005198 structural molecule activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040801-201 Predicted to enable structural molecule activity. Predicted to be involved in bicellular tight junction assembly and cell adhesion. Predicted to be located in cell junction and membrane. Predicted to be integral component of membrane. Predicted to be active in bicellular tight junction and plasma membrane. Is expressed in integument and nervous system. Orthologous to human CLDN17 (claudin 17).

Ensembl:

ensembl_id ENSDART00000189920

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00053126 lncRNA downstream 185997 49934636 ~ 49937735 (-) True XLOC_026761
TCONS_00053125 lncRNA downstream 198455 49921198 ~ 49925277 (-) True XLOC_026760
TCONS_00052500 lncRNA downstream 333702 49766966 ~ 49790030 (-) False XLOC_026760
TCONS_00053124 lncRNA downstream 705387 49406158 ~ 49418345 (-) True XLOC_026754
TCONS_00053123 lncRNA downstream 751547 49206136 ~ 49372185 (-) True XLOC_026752
TCONS_00052091 lncRNA upstream 3853 50128266 ~ 50139846 (-) False XLOC_026766
TCONS_00052098 lncRNA upstream 148743 50273156 ~ 50277941 (-) True XLOC_026768
TCONS_00053127 lncRNA upstream 214367 50338780 ~ 50341046 (-) True XLOC_026769
TCONS_00053128 lncRNA upstream 309138 50433551 ~ 50438278 (-) True XLOC_026770
TCONS_00052501 lncRNA upstream 309380 50433793 ~ 50434423 (-) True XLOC_026771
TCONS_00052086 mRNA downstream 5592 50076793 ~ 50118140 (-) False XLOC_026764
TCONS_00052084 mRNA downstream 57204 50054187 ~ 50066528 (-) False XLOC_026763
TCONS_00052085 mRNA downstream 57233 50054373 ~ 50066499 (-) True XLOC_026763
TCONS_00052083 mRNA downstream 77728 50032394 ~ 50046004 (-) True XLOC_026762
TCONS_00052081 mRNA downstream 198419 49757578 ~ 49925313 (-) False XLOC_026760
TCONS_00052090 mRNA upstream 3313 50127726 ~ 50136424 (-) False XLOC_026766
TCONS_00052092 mRNA upstream 4068 50128481 ~ 50139860 (-) False XLOC_026766
TCONS_00052093 mRNA upstream 4156 50128569 ~ 50147160 (-) False XLOC_026766
TCONS_00052094 mRNA upstream 17278 50141691 ~ 50146854 (-) True XLOC_026766
TCONS_00052095 mRNA upstream 50753 50175166 ~ 50177658 (-) True XLOC_026767
TCONS_00052087 other downstream 5770 50104071 ~ 50117962 (-) True XLOC_026764
TCONS_00052082 other downstream 308445 49815197 ~ 49815287 (-) False XLOC_026760
TCONS_00052070 other downstream 1045853 49077762 ~ 49077879 (-) True XLOC_026748
TCONS_00052055 other downstream 2928498 47195137 ~ 47195234 (-) True XLOC_026732
TCONS_00052007 other downstream 6029506 44081623 ~ 44094226 (-) False XLOC_026707
TCONS_00052109 other upstream 1423720 51548133 ~ 51548250 (-) True XLOC_026779
TCONS_00052111 other upstream 1783073 51907486 ~ 51907562 (-) True XLOC_026783
TCONS_00052136 other upstream 3564897 53689310 ~ 53689428 (-) True XLOC_026804
TCONS_00052148 other upstream 4938854 55063267 ~ 55079244 (-) True XLOC_026816
TCONS_00052166 other upstream 5331940 55456353 ~ 55481157 (-) True XLOC_026827

Expression Profile

//