RNA id: TCONS_00052186


Basic Information

Item Value
RNA id TCONS_00052186
length 410
RNA type processed_transcript
GC content 0.49
exon number 3
gene id XLOC_026833
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 56408840 ~ 56574965 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ACGCACACATCCGTGACAACAAAGAAAGCTGTTTAAAGTAAGCTCACAGACACCGACAGAGTAACAAAGTGACAAAAGGTATGTTTAGATTGAGAAAATGTCACCGCAGGGACAGTAAAGTCACTCACCCGTCACCGACGACCACACACTTGATGGCCTGCATGACTTTTACTCGATTTTTGCTCTCCCTCCGCGCGGAACTGATGAAAAAACCCCTCTAACGAGCGACGCCGCTTCAAACAACACCAGTCACAGCTGCACGTACCTGAAGACCTGTCCTTAGAAGAGAGAGATGAGCTGTCCAACATAAGGCGCAGAAAAAAAGAGCTGCTCGATGACATTGAGCGGCTGAAGTTCGAGATCGCTGAAGTGATGACAGAAATTGAGCAGCTCACGTGTGTGGGCGAGAG

Function

GO:

id name namespace
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0032012 regulation of ARF protein signal transduction biological_process

KEGG: NA

Ensembl:

ensembl_id ENSDART00000155003

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00052184 lncRNA downstream 67789 56411141 ~ 56413023 (-) True XLOC_026834
TCONS_00053146 lncRNA downstream 641298 55838454 ~ 55839514 (-) True XLOC_026831
TCONS_00052162 lncRNA downstream 1152299 55314588 ~ 55328513 (-) True XLOC_026825
TCONS_00052151 lncRNA downstream 1376555 55103445 ~ 55104257 (-) False XLOC_026819
TCONS_00052153 lncRNA downstream 1376724 55103447 ~ 55104088 (-) True XLOC_026819
TCONS_00052190 lncRNA upstream 26960 56601925 ~ 56614135 (-) True XLOC_026836
TCONS_00053147 lncRNA upstream 462129 57037094 ~ 57037670 (-) True XLOC_026840
TCONS_00052211 lncRNA upstream 1482649 58057614 ~ 58059819 (-) True XLOC_026851
TCONS_00053148 lncRNA upstream 1533466 58108431 ~ 58110148 (-) False XLOC_026854
TCONS_00052214 lncRNA upstream 1533466 58108431 ~ 58110154 (-) True XLOC_026854
TCONS_00052179 mRNA downstream 24285 56408840 ~ 56456527 (-) False XLOC_026833
TCONS_00052178 mRNA downstream 124846 56354644 ~ 56355966 (-) True XLOC_026832
TCONS_00052177 mRNA downstream 450695 55684449 ~ 56030117 (-) False XLOC_026830
TCONS_00052176 mRNA downstream 450695 55684449 ~ 56030117 (-) True XLOC_026830
TCONS_00052173 mRNA downstream 830041 55631128 ~ 55650771 (-) False XLOC_026829
TCONS_00052188 mRNA upstream 26864 56601829 ~ 56617097 (-) False XLOC_026836
TCONS_00052193 mRNA upstream 286094 56861059 ~ 56871984 (-) False XLOC_026837
TCONS_00052192 mRNA upstream 286094 56861059 ~ 56871984 (-) False XLOC_026837
TCONS_00052191 mRNA upstream 286094 56861059 ~ 56871984 (-) False XLOC_026837
TCONS_00052194 mRNA upstream 286147 56861112 ~ 56871330 (-) True XLOC_026837
TCONS_00052174 other downstream 830395 55644209 ~ 55650417 (-) False XLOC_026829
TCONS_00052166 other downstream 999655 55456353 ~ 55481157 (-) True XLOC_026827
TCONS_00052148 other downstream 1401568 55063267 ~ 55079244 (-) True XLOC_026816
TCONS_00052136 other downstream 2791384 53689310 ~ 53689428 (-) True XLOC_026804
TCONS_00052111 other downstream 4573250 51907486 ~ 51907562 (-) True XLOC_026783
TCONS_00052189 other upstream 26935 56601900 ~ 56617041 (-) False XLOC_026836
TCONS_00052254 other upstream 3876535 60451500 ~ 60451628 (-) True XLOC_026892

Expression Profile

//