RNA id: TU2143924



Basic Information


Item Value
RNA id TU2143924
length 213
lncRNA type inter_gene
GC content 0.58
exon number 1
gene id G1873996
representative True

Chromosome Information


Item Value
chromosome id NC_048587.1
NCBI id CM023241.2
chromosome length 62880378
location 48152547 ~ 48152759 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CGGACTTCCCCAGGACATTGTCTCAGATCGTGGGCCCCAGTTCGTCGCACGGAATTGGAAATCCTTCTGGGGGCGTCAGTGAGTCTCTCCTCTGGATTCCACCCACAGTCGAATGGCCAACCAGGAGCTGGAGAATTTCCCCCGCTGTTTCATTTCCACCAAGGCCAGCAACTGGAGCCCGTTCCTCGTCTGGGTGAAGAATGCTCACCCCCC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU2143903 lncRNA downstream 14966 48137338 ~ 48137581 (-) True G1873975
TU2143900 lncRNA downstream 17464 48134840 ~ 48135083 (-) True G1873972
TU2143890 lncRNA downstream 24663 48127593 ~ 48127884 (-) True G1873962
TU2143879 lncRNA downstream 29115 48117425 ~ 48123432 (-) True G1873951
TU2143875 lncRNA downstream 40522 48111811 ~ 48112025 (-) True G1873948
TU2144204 lncRNA upstream 47066 48199825 ~ 48235054 (-) True G1874225
TU2144217 lncRNA upstream 104149 48256908 ~ 48257146 (-) True G1874235
TU2144218 lncRNA upstream 104481 48257240 ~ 48257448 (-) True G1874236
TU2144185 lncRNA upstream 189875 48342634 ~ 48343270 (-) True G1874207
TU2144262 lncRNA upstream 224640 48377399 ~ 48378918 (-) True G1874274
XM_021581241.2 mRNA downstream 73062 48040588 ~ 48079485 (-) True LOC110502894
XM_036959909.1 mRNA downstream 263236 47801102 ~ 47889311 (-) False LOC110502890
XM_021581230.2 mRNA downstream 694538 47450667 ~ 47458009 (-) True LOC110502884
XM_021581231.2 mRNA downstream 694799 47450667 ~ 47457748 (-) False LOC110502884
XM_036960612.1 mRNA downstream 898112 47232147 ~ 47254435 (-) True LOC110502880
XM_036960655.1 mRNA upstream 4952 48157711 ~ 48169661 (-) False LOC110502896
XM_036960654.1 mRNA upstream 4952 48157711 ~ 48289997 (-) True LOC110502896
XM_036960657.1 mRNA upstream 208647 48361406 ~ 48372720 (-) True LOC110502897
XR_005039226.1 mRNA upstream 227835 48380594 ~ 48385682 (-) False LOC110502900
XM_036960666.1 mRNA upstream 290710 48443469 ~ 48475356 (-) False LOC110503131
TU2143011 other downstream 892614 47257593 ~ 47259933 (-) False G1873183
TU2142821 other downstream 1072757 47067908 ~ 47079790 (-) False LOC110502870
TU2142808 other downstream 1190894 46960622 ~ 46961653 (-) True G1873043
TU2142791 other downstream 1210090 46941286 ~ 46942457 (-) True G1873030
TU2142235 other downstream 1354897 46797235 ~ 46797650 (-) True G1872556
TU2144319 other upstream 367920 48520679 ~ 48521672 (-) True LOC110502901
TU2144817 other upstream 485232 48637991 ~ 48641871 (-) True LOC110503133
TU2144859 other upstream 576853 48729612 ~ 48737282 (-) True LOC110502911
TU2145415 other upstream 1151760 49304519 ~ 49307135 (-) False G1875310
TU2146049 other upstream 1628853 49781612 ~ 49846328 (-) True LOC110503141

Expression Profile


TU2143924 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU2143924 Expression in each Bioproject

Bar chart with 8 bars.
TU2143924 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.