Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

RNA id: TU2161229

Basic Information

Item	Value
RNA id	TU2161229
length	232
lncRNA type	intronic
GC content	0.49
exon number	2
gene id	G1889121
representative	True

Chromosome Information

Item	Value
chromosome id	NC_048587.1
NCBI id	CM023241.2
chromosome length	62880378
location	62668820 ~ 62669697 (-)
genome version	USDA_OmykA_1.1_2020_rainbow_trout_Genome
species	rainbow trout (Oncorhynchus mykiss)

Sequence

gtatagtggtctgatacggctggtatagtggtctgatacggctggtatagtggtctgataaggctggtatagtggtctgatacggctggtatagaggtctgatacggctggtatagtggtctgatacggctggtatagaggtctcacaatacggctggtatagtggtctgatacggctggtatagaggtctcacaatacggctggtatagtggtctgatacggctggtatag

Function

GO: NA

KEGG: NA

JBrowse2

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

RNA id	RNA type	direction	distance	location	representative	gene id
TU2161068	lncRNA	downstream	91877	62576700 ~ 62576943 (-)	True	G1888973
TU2161061	lncRNA	downstream	116335	62548077 ~ 62552485 (-)	False	G1888968
TU2161063	lncRNA	downstream	116335	62552006 ~ 62552485 (-)	True	G1888968
TU2161062	lncRNA	downstream	117842	62547641 ~ 62550978 (-)	False	G1888968
TU2161043	lncRNA	downstream	165637	62502146 ~ 62503183 (-)	True	G1888952
TU2161235	lncRNA	upstream	22831	62692528 ~ 62692943 (-)	True	G1889127
TU2161243	lncRNA	upstream	47561	62717258 ~ 62717648 (-)	True	G1889133
TU2161268	lncRNA	upstream	112944	62782641 ~ 62783284 (-)	True	LOC118943943
XM_036961018.1	mRNA	downstream	98145	62560678 ~ 62570675 (-)	True	LOC118936590
XM_036961015.1	mRNA	downstream	108284	62492107 ~ 62560536 (-)	True	LOC118943941
XM_036961014.1	mRNA	downstream	109795	62491881 ~ 62559025 (-)	False	LOC118943941
XM_036961031.1	mRNA	upstream	100338	62770035 ~ 62776649 (-)	False	LOC118943942
XM_036961030.1	mRNA	upstream	100338	62770035 ~ 62776655 (-)	True	LOC118943942
XM_036961032.1	mRNA	upstream	111402	62781099 ~ 62876729 (-)	False	LOC118943943
TU2160891	other	downstream	394993	62269622 ~ 62273827 (-)	False	LOC110532867
TU2160893	other	downstream	394993	62269741 ~ 62273827 (-)	True	LOC110532867
TU2160887	other	downstream	401315	62260837 ~ 62267505 (-)	True	G1888836
TU2160862	other	downstream	506431	62155228 ~ 62162389 (-)	False	LOC118943840

Expression Profile