RNA id: TCONS_00053336


Basic Information

Item Value
RNA id TCONS_00053336
length 562
RNA type nonsense_mediated_decay
GC content 0.48
exon number 5
gene id XLOC_027055
representative False

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 5506946 ~ 5522437 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGAGACTGAAGCCGGCTGCCTCCACGCACAGGCACATCCCTTTGGCGGATGCGTTAGTGTTTTCCTTACACTTTTACAGTAAAGAGCGTCTTTTTAAACGGAAAACATGGCGACAAGACCGGGATTCTACCGGCAAGAATTAAACAAGACTGTCTGGGAGGTGCCAGAACGATACCAGAACCTTACACCGGTTGGATCGGGGGCATATGGCTCAGTATGGTGAGTCCAGCAGCTCAGCATATGACGTGCGCCTTCGTCAGAAAGTGGCCGTGAAGAAGCTCTCCAGGCCTTTCCAGTCCCTCATCCACAGCAGAAGAACATACAGAGAACTGAGACTACTCAAACACATGAAGCACGAGAATGTTATTGGACTGCTGGACGTTTTCACTCCGGCAGCTTCTCTCGAGGAATTCAATGAGCTATCTAGTGACCAATCTGATGGGAGCAGATCTTAACAACATTGTCAAGTTTCAAAGACTTTCAGACGAACACGTACAATTCCTCATCTATCAGCTTCTTCGGGGCCTTAAGTACATCCATTCAGCTGGACTGATACACAGAG

Function

GO:

id name namespace
GO:0030097 hemopoiesis biological_process
GO:0044085 cellular component biogenesis biological_process
GO:0030099 myeloid cell differentiation biological_process
GO:0048731 system development biological_process
GO:0002520 immune system development biological_process
GO:0002262 myeloid cell homeostasis biological_process
GO:0000027 ribosomal large subunit assembly biological_process
GO:0000028 ribosomal small subunit assembly biological_process
GO:0071826 ribonucleoprotein complex subunit organization biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0022618 ribonucleoprotein complex assembly biological_process
GO:0008152 metabolic process biological_process
GO:0043009 chordate embryonic development biological_process
GO:0051726 regulation of cell cycle biological_process
GO:0019538 protein metabolic process biological_process
GO:0043603 cellular amide metabolic process biological_process
GO:0048513 animal organ development biological_process
GO:0035556 intracellular signal transduction biological_process
GO:0043604 amide biosynthetic process biological_process
GO:1901564 organonitrogen compound metabolic process biological_process
GO:1901566 organonitrogen compound biosynthetic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:0043043 peptide biosynthetic process biological_process
GO:0048534 hematopoietic or lymphoid organ development biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0007275 multicellular organism development biological_process
GO:0006412 translation biological_process
GO:0006414 translational elongation biological_process
GO:0030218 erythrocyte differentiation biological_process
GO:0048856 anatomical structure development biological_process
GO:0010467 gene expression biological_process
GO:0044237 cellular metabolic process biological_process
GO:0006468 protein phosphorylation biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044238 primary metabolic process biological_process
GO:0048872 homeostasis of number of cells biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0042254 ribosome biogenesis biological_process
GO:0042255 ribosome assembly biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0044267 cellular protein metabolic process biological_process
GO:0000470 maturation of LSU-rRNA biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0042273 ribosomal large subunit biogenesis biological_process
GO:0042274 ribosomal small subunit biogenesis biological_process
GO:0071704 organic substance metabolic process biological_process
GO:0070925 organelle assembly biological_process
GO:0006518 peptide metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0009987 cellular process biological_process
GO:0034622 cellular protein-containing complex assembly biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:0034101 erythrocyte homeostasis biological_process
GO:0032501 multicellular organismal process biological_process
GO:0002181 cytoplasmic translation biological_process
GO:0032502 developmental process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0016310 phosphorylation biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0009790 embryo development biological_process
GO:0009792 embryo development ending in birth or egg hatching biological_process
GO:0044391 ribosomal subunit cellular_component
GO:0044422 obsolete organelle part cellular_component
GO:0044424 obsolete intracellular part cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0022625 cytosolic large ribosomal subunit cellular_component
GO:0022626 cytosolic ribosome cellular_component
GO:0022627 cytosolic small ribosomal subunit cellular_component
GO:0044444 obsolete cytoplasmic part cellular_component
GO:0044445 obsolete cytosolic part cellular_component
GO:0044446 obsolete intracellular organelle part cellular_component
GO:0044464 obsolete cell part cellular_component
GO:0005829 cytosol cellular_component
GO:0005840 ribosome cellular_component
GO:1905368 peptidase complex cellular_component
GO:1905369 endopeptidase complex cellular_component
GO:0032991 protein-containing complex cellular_component
GO:0015934 large ribosomal subunit cellular_component
GO:0015935 small ribosomal subunit cellular_component
GO:0005622 intracellular anatomical structure cellular_component
GO:0005623 obsolete cell cellular_component
GO:0005634 nucleus cellular_component
GO:0000502 proteasome complex cellular_component
GO:0043226 organelle cellular_component
GO:0043228 non-membrane-bounded organelle cellular_component
GO:0043229 intracellular organelle cellular_component
GO:0043232 intracellular non-membrane-bounded organelle cellular_component
GO:0005737 cytoplasm cellular_component
GO:0016740 transferase activity molecular_function
GO:0005524 ATP binding molecular_function
GO:0019843 rRNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0005198 structural molecule activity molecular_function
GO:0000166 nucleotide binding molecular_function
GO:0003723 RNA binding molecular_function
GO:0003735 structural constituent of ribosome molecular_function
GO:0004672 protein kinase activity molecular_function
GO:0004674 protein serine/threonine kinase activity molecular_function
GO:0016301 kinase activity molecular_function
GO:0004707 MAP kinase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040625-75 Predicted to enable MAP kinase activity. Predicted to be involved in intracellular signal transduction. Predicted to act upstream of or within protein phosphorylation. Predicted to be active in cytoplasm and nucleus. Is expressed in granule cell. Orthologous to human MAPK11 (mitogen-activated protein kinase 11).

Ensembl:

ensembl_id ENSDART00000150724

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00057590 lncRNA upstream 50004 5424860 ~ 5456948 (+) False XLOC_027053
TCONS_00057591 lncRNA upstream 50004 5424972 ~ 5456948 (+) True XLOC_027053
TCONS_00057587 lncRNA upstream 50894 5420906 ~ 5456058 (+) False XLOC_027052
TCONS_00053341 lncRNA downstream 12832 5528694 ~ 5530359 (+) True XLOC_027056
TCONS_00053345 lncRNA downstream 22075 5537937 ~ 5539842 (+) True XLOC_027058
TCONS_00053347 lncRNA downstream 126852 5642714 ~ 5644808 (+) True XLOC_027059
TCONS_00053353 lncRNA downstream 309506 5825368 ~ 5826340 (+) True XLOC_027063
TCONS_00057127 lncRNA downstream 441541 5957403 ~ 5963871 (+) True XLOC_027069
TCONS_00053329 mRNA upstream 12654 5392094 ~ 5494298 (+) False XLOC_027051
TCONS_00053328 mRNA upstream 119474 5378338 ~ 5387478 (+) True XLOC_027050
TCONS_00053327 mRNA upstream 138794 5341592 ~ 5368158 (+) True XLOC_027049
TCONS_00053326 mRNA upstream 142120 5341592 ~ 5364832 (+) False XLOC_027049
TCONS_00053324 mRNA upstream 166422 5334439 ~ 5340530 (+) False XLOC_027048
TCONS_00053340 mRNA downstream 7828 5523690 ~ 5530441 (+) False XLOC_027056
TCONS_00053342 mRNA downstream 15721 5531583 ~ 5533756 (+) False XLOC_027057
TCONS_00053343 mRNA downstream 15727 5531589 ~ 5533803 (+) True XLOC_027057
TCONS_00053344 mRNA downstream 21239 5537101 ~ 5539842 (+) False XLOC_027058
TCONS_00053346 mRNA downstream 126834 5642696 ~ 5645166 (+) False XLOC_027059
TCONS_00053334 other upstream 12654 5488281 ~ 5494298 (+) True XLOC_027051
TCONS_00053333 other upstream 28604 5465998 ~ 5478348 (+) False XLOC_027051
TCONS_00053330 other upstream 89965 5403115 ~ 5416987 (+) False XLOC_027051
TCONS_00053314 other upstream 233114 5255078 ~ 5273838 (+) True XLOC_027045
TCONS_00053296 other upstream 618448 4834085 ~ 4888504 (+) False XLOC_027034
TCONS_00053350 other downstream 262367 5778229 ~ 5784871 (+) True XLOC_027061
TCONS_00053381 other downstream 1398854 6914716 ~ 6914851 (+) True XLOC_027079
TCONS_00053382 other downstream 1509305 7025167 ~ 7025283 (+) True XLOC_027081
TCONS_00053383 other downstream 1647896 7163758 ~ 7163874 (+) True XLOC_027083
TCONS_00053390 other downstream 1899475 7415337 ~ 7415437 (+) True XLOC_027085

Expression Profile

//