RNA id: TCONS_00053347


Basic Information

Item Value
RNA id TCONS_00053347
length 610
lncRNA type retained_intron
GC content 0.47
exon number 5
gene id XLOC_027059
representative True

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 5642696 ~ 5645166 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAAGAAAGCATGGCGGCGCGCTGTGTTTTGCAGTCTGCAAGGACAGCGGTGAGATCCGCTCAAAATACCCTCGATAAAAGCACAAGCTTATTCCAGAGAATACCGGGTTTTTCACAGCATTCATTTTTAGGGATTACGCCGTGTCGCGGTCTTAGACATGTGGCAGAGAAGAAGGAAGGCAAAACAACCATTATTGAGGGTTTCATAGAGACTACAACTGAGCAACCGCAGCCTCCTAACCCCACGGCGTCCTGTCCCATCTACCGATGGAACTTACAGAACAAATACAACTACACTGTAAGTGTTAACACTTCTGACGATTCTTAGTTTTAACAATGTTTCATATCTCAAAACTTCTCTCACTCTAAATGTGATGCAGGATGTGCTGTTACTCAGTCAGTTCATTCGCTCAGATGGTGGGTTACTCCCCCGGCGCATTACAGGCCTCTGTGCTCAGGAACATAACAAGATAGCAATATGTGTACAGATGGCCCATCGTGCAGGTCTCCTACCAGATCACAGGCCCCGCTTACCTGAAGGTCATGTTCCAAAACCCAAACCACATCCACCTCTCAACCGATATCTGACACGGTACTCTGTGAAGTCTGTG

Function

GO:

id name namespace
GO:0006412 translation biological_process
GO:0005763 mitochondrial small ribosomal subunit cellular_component
GO:0005840 ribosome cellular_component
GO:0003735 structural constituent of ribosome molecular_function
GO:0070181 small ribosomal subunit rRNA binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-041210-109 Predicted to enable small ribosomal subunit rRNA binding activity. Predicted to be a structural constituent of ribosome. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of mitochondrial small ribosomal subunit. Orthologous to human MRPS18A (mitochondrial ribosomal protein S18A).

Ensembl:

ensembl_id ENSDART00000150847

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00053345 lncRNA upstream 102872 5537937 ~ 5539842 (+) True XLOC_027058
TCONS_00053341 lncRNA upstream 112355 5528694 ~ 5530359 (+) True XLOC_027056
TCONS_00053339 lncRNA upstream 123295 5515031 ~ 5519419 (+) True XLOC_027055
TCONS_00053335 lncRNA upstream 129323 5506946 ~ 5513391 (+) False XLOC_027055
TCONS_00057595 lncRNA upstream 186656 5452055 ~ 5456058 (+) True XLOC_027052
TCONS_00053353 lncRNA downstream 180560 5825368 ~ 5826340 (+) True XLOC_027063
TCONS_00057127 lncRNA downstream 312595 5957403 ~ 5963871 (+) True XLOC_027069
TCONS_00053364 lncRNA downstream 771470 6416278 ~ 6508633 (+) False XLOC_027071
TCONS_00053365 lncRNA downstream 860825 6505633 ~ 6508633 (+) False XLOC_027071
TCONS_00053366 lncRNA downstream 860890 6505698 ~ 6508633 (+) False XLOC_027071
TCONS_00053344 mRNA upstream 102872 5537101 ~ 5539842 (+) False XLOC_027058
TCONS_00053343 mRNA upstream 108911 5531589 ~ 5533803 (+) True XLOC_027057
TCONS_00053342 mRNA upstream 108958 5531583 ~ 5533756 (+) False XLOC_027057
TCONS_00053340 mRNA upstream 112273 5523690 ~ 5530441 (+) False XLOC_027056
TCONS_00053337 mRNA upstream 120277 5506952 ~ 5522437 (+) False XLOC_027055
TCONS_00053348 mRNA downstream 96925 5741733 ~ 5744457 (+) True XLOC_027060
TCONS_00053349 mRNA downstream 131539 5776347 ~ 5784895 (+) False XLOC_027061
TCONS_00053351 mRNA downstream 151953 5796761 ~ 5806144 (+) False XLOC_027062
TCONS_00053352 mRNA downstream 153415 5798223 ~ 5807645 (+) True XLOC_027062
TCONS_00053354 mRNA downstream 187503 5832311 ~ 5834624 (+) False XLOC_027064
TCONS_00053336 other upstream 126852 5506952 ~ 5515862 (+) False XLOC_027055
TCONS_00053334 other upstream 148416 5488281 ~ 5494298 (+) True XLOC_027051
TCONS_00053333 other upstream 164366 5465998 ~ 5478348 (+) False XLOC_027051
TCONS_00053330 other upstream 225727 5403115 ~ 5416987 (+) False XLOC_027051
TCONS_00053314 other upstream 368876 5255078 ~ 5273838 (+) True XLOC_027045
TCONS_00053350 other downstream 133421 5778229 ~ 5784871 (+) True XLOC_027061
TCONS_00053381 other downstream 1269908 6914716 ~ 6914851 (+) True XLOC_027079
TCONS_00053382 other downstream 1380359 7025167 ~ 7025283 (+) True XLOC_027081
TCONS_00053383 other downstream 1518950 7163758 ~ 7163874 (+) True XLOC_027083
TCONS_00053390 other downstream 1770529 7415337 ~ 7415437 (+) True XLOC_027085

Expression Profile

//