RNA id: TU2178133



Basic Information


Item Value
RNA id TU2178133
length 442
RNA type TUCP
GC content 0.51
exon number 3
gene id G1904408
representative True

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 13757828 ~ 13758644 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gggggatgcagaacagctgaacaaggccacaatttgccgcacaataaggagtgtgtgtctggctatcaaagcattagcagatgtcttcatctccttccctggccacagaagactctgtgacatcaaagaggagttctataggattgcagatggtctgcaatgctgactgtgtgatcagcaatgttgtggcaaaatggcctggctcagtccatgactccagaatctttcaggcctctgaaatctatcagtgcctatcacaaggtgaattctctggtgtgttgctgggagacagggggtatggctgccagccttttctcctgacacctttcacagacccccaggaagcacagcaggcctacaaccatgcccatgccaggaccagggccagagttgaaatgacctttggcctcctgaaggcacgctttcactgccttcacaaatt

Function


GO: NA

KEGG:

id description

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU2178123 lncRNA downstream 16309 13741198 ~ 13741519 (-) True G1904398
TU2178120 lncRNA downstream 17274 13734759 ~ 13740554 (-) True G1904396
TU2178117 lncRNA downstream 27563 13730028 ~ 13730265 (-) True G1904393
TU2178115 lncRNA downstream 29766 13727785 ~ 13728062 (-) True G1904391
TU2178113 lncRNA downstream 31178 13726407 ~ 13726650 (-) True G1904389
TU2178152 lncRNA upstream 22697 13781341 ~ 13786197 (-) True G1904423
TU2178216 lncRNA upstream 112949 13871593 ~ 13872018 (-) True G1904486
TU2178598 lncRNA upstream 253514 14012158 ~ 14012456 (-) True G1904829
TU2178606 lncRNA upstream 270127 14028771 ~ 14029064 (-) True G1904836
TU2178608 lncRNA upstream 272324 14030968 ~ 14031172 (-) True G1904838
NM_001160674.1 mRNA downstream 38381 13717967 ~ 13719447 (-) False rabx5
XM_036961191.1 mRNA downstream 50686 13702362 ~ 13707142 (-) True LOC110503800
XM_021582337.2 mRNA downstream 50687 13702362 ~ 13707141 (-) False LOC110503800
XM_021582338.2 mRNA downstream 50688 13702362 ~ 13707140 (-) False LOC110503800
XM_021582333.2 mRNA downstream 91353 13613805 ~ 13666475 (-) True LOC110503795
XM_021581696.2 mRNA upstream 53008 13811652 ~ 13812593 (-) True LOC110503330
XM_021581699.2 mRNA upstream 128875 13887519 ~ 13888439 (-) True LOC110503333
XM_021581700.2 mRNA upstream 136641 13895285 ~ 13896205 (-) True LOC110503334
XM_036961074.1 mRNA upstream 144395 13903039 ~ 13903959 (-) True LOC118943997
XM_021581701.2 mRNA upstream 154713 13913357 ~ 13914277 (-) True LOC110503335
TU2178084 other downstream 38377 13716650 ~ 13719451 (-) True rabx5
TU2177124 other downstream 1033831 12717450 ~ 12723997 (-) False LOC110503775
TU2177125 other downstream 1039049 12717450 ~ 12718779 (-) True LOC110503775
TU2176372 other downstream 1705180 11967842 ~ 12052648 (-) True G1902875
TU2176356 other downstream 1777366 11979811 ~ 11980462 (-) True LOC110503324
TU2178616 other upstream 284326 14042970 ~ 14043449 (-) True G1904846
TU2178650 other upstream 331078 14089722 ~ 14142728 (-) True G1904877
TU2178696 other upstream 421419 14180063 ~ 14214520 (-) True G1904919
TU2179185 other upstream 861019 14619663 ~ 14621372 (-) False G1905348
TU2179186 other upstream 861019 14619663 ~ 14621372 (-) True G1905348

Expression Profile


TU2178133 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU2178133 Expression in each Bioproject

Bar chart with 19 bars.
TU2178133 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.