RNA id: TU2178696



Basic Information


Item Value
RNA id TU2178696
length 606
RNA type TUCP
GC content 0.48
exon number 2
gene id G1904919
representative True

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 14180063 ~ 14214520 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


aagaggctcccacgctgaggtctgttcaacgctggtccgaccaatctgattccacactccaagactgcttccatcacgtggactgggatatgtttcgtattgcgtcagacaacaacattgacgaatacgctgattcggtgtgcgagttcattagaacgtgcgttgaagatgtcgttcccatagcaacgattaaaacattcccaaaccagaaaccgtggattgatggcagcattcgcgtgaaactgaaagcgcgaaccactgcttttaatcagggcaaggtgaccggtaacatgaccgaatacaaacagtgtagctattccctccgcaaggcaatcaaacaagctaagcgtcagtatagagacaaagtagaatctcaattcaacggctcagacacaagaggtatgtggcagggtctacagtcaatcacggattacaaaaataaaaccagccccgtcacggaccaggatgtcttgctcccaggcagactaaataacttttttgcccgctttgaggacaatacagtgccactgacacggcctgcaaccaaaacatgcggcctctccttcactgcagccgaggtgagtaaaacatttaaacgtgttaacc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU2178694 lncRNA downstream 257 14179503 ~ 14179806 (-) True G1904918
TU2178691 lncRNA downstream 3393 14176126 ~ 14176670 (-) True G1904915
TU2178690 lncRNA downstream 5385 14174321 ~ 14174678 (-) True G1904914
TU2178683 lncRNA downstream 17945 14161879 ~ 14162118 (-) True G1904909
TU2178680 lncRNA downstream 29674 14150043 ~ 14150389 (-) True G1904906
TU2178711 lncRNA upstream 2609 14217129 ~ 14217351 (-) True G1904934
TU2178712 lncRNA upstream 2890 14217410 ~ 14217656 (-) True G1904935
TU2178715 lncRNA upstream 8102 14222622 ~ 14222850 (-) True G1904938
TU2178716 lncRNA upstream 8562 14223082 ~ 14223312 (-) True G1904939
TU2178718 lncRNA upstream 11279 14225799 ~ 14227143 (-) True G1904941
XM_021582344.2 mRNA downstream 154016 14021980 ~ 14026047 (-) True LOC110503806
XM_021582342.2 mRNA downstream 160849 14015443 ~ 14019214 (-) False aamdc
XM_021582343.2 mRNA downstream 160849 14015443 ~ 14019214 (-) True aamdc
XR_005039443.1 mRNA downstream 180386 13999529 ~ 13999677 (-) True LOC118944122
XR_005039441.1 mRNA downstream 181123 13998794 ~ 13998940 (-) True LOC118944120
XM_036961223.1 mRNA upstream 190241 14404761 ~ 14420983 (-) False LOC110503811
XM_036961222.1 mRNA upstream 190241 14404761 ~ 14431484 (-) False LOC110503811
XM_036961220.1 mRNA upstream 190241 14404761 ~ 14454378 (-) False LOC110503811
XM_036961221.1 mRNA upstream 190241 14404761 ~ 14465943 (-) False LOC110503811
XM_036961218.1 mRNA upstream 190241 14404761 ~ 14512956 (-) False LOC110503811
TU2178650 other downstream 37335 14089722 ~ 14142728 (-) True G1904877
TU2178616 other downstream 136614 14042970 ~ 14043449 (-) True G1904846
TU2178133 other downstream 421419 13757828 ~ 13758644 (-) True G1904408
TU2178084 other downstream 460612 13716650 ~ 13719451 (-) True rabx5
TU2177124 other downstream 1456066 12717450 ~ 12723997 (-) False LOC110503775
TU2179185 other upstream 405143 14619663 ~ 14621372 (-) False G1905348
TU2179186 other upstream 405143 14619663 ~ 14621372 (-) True G1905348
TU2179145 other upstream 407675 14622195 ~ 14655274 (-) False G1905324
TU2179146 other upstream 407675 14622195 ~ 14655274 (-) True G1905324
TU2179616 other upstream 726170 14940690 ~ 14941172 (-) True G1905737

Expression Profile


TU2178696 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU2178696 Expression in each Bioproject

Bar chart with 20 bars.
TU2178696 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.