RNA id: TCONS_00053542


Basic Information

Item Value
RNA id TCONS_00053542
length 501
lncRNA type retained_intron
GC content 0.49
exon number 3
gene id XLOC_027168
representative False

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 12292274 ~ 12307834 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTTTCGGCATCCTCTCCAACTGCTGCCACTGCTACTGCCTCAAGTGCATCAGGAAATGGCGAAGCGCCAAGCAGTTCGAGAGCAAGATCATAAAGTCCTGCCCAGAGTGTCGAATTACATCAAACTTTGTCATACCAAGCGAATACTGGGTGGAGGACAAGGAGGAAAAGCAGCAACTCATTCAGAAGTACAAGGATGGCATGGGAACTAAACCATGCCGATATTTTGATGAAGGCCGTGGGACCTGTCCGTTTGGAGCCAACTGCTTTTACAAGCACGCTTTCCCTGACGGGCGTCTGGAAGAGCCTCAACCCCAGAGGAGACAGAACGGCTCCAATGGAAGAAACCGGGTAAGGCTTCAACTCGATGCTAGTGCCAAATAGCATAAAAGCATATCATATTTACTTTTACAATGTGCAACGGAGCCATTAATGGACTCTGTATTGCAGAACACCAGACGGACGCATCTCTGGGATCTTTTAGACGAGCGGGAGAACAGCG

Function

GO:

id name namespace
GO:0016567 protein ubiquitination biological_process
GO:0016740 transferase activity molecular_function
GO:0046872 metal ion binding molecular_function
GO:0061630 ubiquitin protein ligase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-020213-1 Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in protein ubiquitination. Is expressed in several structures, including brain; eye; gonad; integument; and liver. Human ortholog(s) of this gene implicated in central precocious puberty 2. Orthologous to several human genes including MKRN1 (makorin ring finger protein 1).

Ensembl:

ensembl_id ENSDART00000131244

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00053540 lncRNA upstream 5631 12292308 ~ 12298977 (+) False XLOC_027168
TCONS_00053539 lncRNA upstream 10939 12292294 ~ 12293669 (+) False XLOC_027168
TCONS_00057647 lncRNA upstream 65448 12234797 ~ 12239160 (+) True XLOC_027167
TCONS_00057646 lncRNA upstream 239245 12063991 ~ 12065363 (+) True XLOC_027166
TCONS_00057645 lncRNA upstream 251938 12039649 ~ 12052670 (+) True XLOC_027165
TCONS_00057649 lncRNA downstream 445920 12752554 ~ 12755202 (+) True XLOC_027175
TCONS_00057650 lncRNA downstream 506566 12813200 ~ 12819377 (+) False XLOC_027176
TCONS_00057651 lncRNA downstream 506942 12813576 ~ 12819377 (+) True XLOC_027176
TCONS_00057652 lncRNA downstream 672878 12979512 ~ 12980325 (+) True XLOC_027179
TCONS_00057653 lncRNA downstream 674062 12980696 ~ 12985047 (+) True XLOC_027181
TCONS_00053535 mRNA upstream 65448 12111154 ~ 12239160 (+) False XLOC_027167
TCONS_00053536 mRNA upstream 74464 12113105 ~ 12230144 (+) False XLOC_027167
TCONS_00053534 mRNA upstream 270742 12031958 ~ 12033866 (+) True XLOC_027164
TCONS_00053532 mRNA upstream 278101 12013043 ~ 12026507 (+) False XLOC_027163
TCONS_00053533 mRNA upstream 280211 12013642 ~ 12024397 (+) True XLOC_027163
TCONS_00053544 mRNA downstream 2342 12308976 ~ 12312976 (+) True XLOC_027169
TCONS_00053545 mRNA downstream 26534 12333168 ~ 12360465 (+) False XLOC_027170
TCONS_00053546 mRNA downstream 26602 12333236 ~ 12336573 (+) False XLOC_027170
TCONS_00053547 mRNA downstream 34021 12340655 ~ 12342586 (+) False XLOC_027170
TCONS_00053548 mRNA downstream 35539 12342173 ~ 12344639 (+) False XLOC_027170
TCONS_00053538 other upstream 2613 12292285 ~ 12301995 (+) False XLOC_027168
TCONS_00053520 other upstream 575478 11724230 ~ 11729130 (+) True XLOC_027159
TCONS_00053515 other upstream 738452 11566040 ~ 11566156 (+) True XLOC_027157
TCONS_00053484 other upstream 1541323 10752740 ~ 10763285 (+) False XLOC_027142
TCONS_00053480 other upstream 1591024 10706755 ~ 10713584 (+) False XLOC_027140
TCONS_00053572 other downstream 1122371 13429005 ~ 13431011 (+) True XLOC_027186
TCONS_00053579 other downstream 1277849 13584483 ~ 13584581 (+) True XLOC_027191
TCONS_00053602 other downstream 1799877 14106511 ~ 14108810 (+) False XLOC_027200
TCONS_00053603 other downstream 1809732 14116366 ~ 14119559 (+) False XLOC_027201
TCONS_00053612 other downstream 2418440 14725074 ~ 14725214 (+) True XLOC_027211

Expression Profile

//