RNA id: TU2204984



Basic Information


Item Value
RNA id TU2204984
length 335
lncRNA type inter_gene
GC content 0.38
exon number 2
gene id G1928179
representative True

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 36159662 ~ 36161083 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gctttgcacacacttggcattatctcaaccagcttcatgaggtagtcacctggaatgcatttcaattaacaggtgtgccttgttaaaagttaatttgtggaatttatttccttcttaatgcatttgagccaatcagttgtgttgtgacaaggtaggggtggtatacagaagatagccctatttggtaaaagaccaagtccatattatggcaagaacagctcaaatatgcaaagagaaacaacagtccatcattacattaaggcatgaaggtcagtcaatgaggaacattttaagaactttaaatgcagtcgcaaaaaccatcaagcactatgatg

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU2204981 lncRNA upstream 4264 36151931 ~ 36155398 (+) True G1928177
TU2204978 lncRNA upstream 11450 36146680 ~ 36148212 (+) False G1928176
TU2204979 lncRNA upstream 11450 36146680 ~ 36148212 (+) False G1928176
TU2204980 lncRNA upstream 12249 36146680 ~ 36147413 (+) True G1928176
TU2204926 lncRNA upstream 41936 36117438 ~ 36117726 (+) True LOC110503248
TU2204963 lncRNA downstream 6546 36167629 ~ 36169286 (+) False G1928170
TU2204961 lncRNA downstream 7337 36168420 ~ 36169286 (+) True G1928170
TU2205005 lncRNA downstream 48895 36209978 ~ 36211963 (+) False G1928196
TU2205006 lncRNA downstream 48895 36209978 ~ 36211294 (+) True G1928196
TU2205072 lncRNA downstream 61105 36222188 ~ 36222543 (+) True G1928239
XM_021581619.2 mRNA upstream 9140 36145024 ~ 36150522 (+) True LOC110503249
XM_036961992.1 mRNA upstream 33442 36124822 ~ 36126220 (+) True LOC110503428
XM_021581618.2 mRNA upstream 39298 36114887 ~ 36120364 (+) False LOC110503248
XM_021581617.2 mRNA upstream 39298 36114888 ~ 36120364 (+) False LOC110503248
XM_036961712.1 mRNA upstream 94008 36041556 ~ 36065654 (+) True LOC110503247
XM_021581620.2 mRNA downstream 2260 36163343 ~ 36166464 (+) True wdr53
XM_036961993.1 mRNA downstream 19476 36180559 ~ 36218330 (+) False LOC110503252
XM_036961995.1 mRNA downstream 19792 36180875 ~ 36218330 (+) False LOC110503252
XM_036961996.1 mRNA downstream 19951 36181034 ~ 36218330 (+) False LOC110503252
XM_036961994.1 mRNA downstream 20013 36181096 ~ 36218330 (+) True LOC110503252
TU2204157 other upstream 777793 35379902 ~ 35381869 (+) True G1927540
TU2203231 other upstream 1522539 34636531 ~ 34637123 (+) False LOC110503217
TU2202773 other upstream 2077927 34080505 ~ 34081735 (+) True G1926351
TU2202187 other upstream 2412916 33745928 ~ 33746746 (+) False G1925870
TU2204953 other downstream 5543 36166626 ~ 36169286 (+) False G1928170
TU2204967 other downstream 6306 36167389 ~ 36169329 (+) False G1928170
TU2204947 other downstream 8333 36169416 ~ 36170471 (+) True G1928169
TU2205324 other downstream 500791 36661874 ~ 36662497 (+) True G1928430
TU2205478 other downstream 896923 37058006 ~ 37063544 (+) True LOC110503264

Expression Profile


TU2204984 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 200.
End of interactive chart.

TU2204984 Expression in each Bioproject

Bar chart with 21 bars.
TU2204984 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 7500.
End of interactive chart.