RNA id: TCONS_00057138


Basic Information

Item Value
RNA id TCONS_00057138
length 204
lncRNA type sense_over
GC content 0.54
exon number 1
gene id XLOC_027217
representative True

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 14926948 ~ 14932359 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCCCGTTTTGATGATGGCGCTGGAGGTGATAATGAAGTGCAGAGAACGATGCTGGAGCTGATCAACCAGCTGGACGGATTCGATCCCAGAGGGAACATTAAAGTCCTGATGGCCACCAACAGACCAGACACCCTAGATCCTGCTCTGATGAGACCCGGCCGTCTGGACAGAAAGATCGAGTTCAGCCTGCCTGACCTGGAAGTA

Function

GO:

id name namespace
GO:0030163 protein catabolic process biological_process
GO:0045899 positive regulation of RNA polymerase II transcription preinitiation complex assembly biological_process
GO:0008540 proteasome regulatory particle, base subcomplex cellular_component
GO:0000502 proteasome complex cellular_component
GO:0043197 dendritic spine cellular_component
GO:0005737 cytoplasm cellular_component
GO:0017025 TBP-class protein binding molecular_function
GO:0005524 ATP binding molecular_function
GO:0016787 hydrolase activity molecular_function
GO:0036402 proteasome-activating ATPase activity molecular_function
GO:0000166 nucleotide binding molecular_function

KEGG:

id description
ko03050 Proteasome
ko05169 Epstein-Barr virus infection
ko05010 Alzheimer disease
ko05012 Parkinson disease
ko05014 Amyotrophic lateral sclerosis
ko05016 Huntington disease
ko05017 Spinocerebellar ataxia
ko05020 Prion disease
ko05022 Pathways of neurodegeneration - multiple diseases
ko03051 Proteasome

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00057673 lncRNA upstream 160754 14767982 ~ 14770585 (+) True XLOC_027214
TCONS_00053614 lncRNA upstream 197056 14727071 ~ 14734283 (+) False XLOC_027212
TCONS_00053607 lncRNA upstream 523041 14399472 ~ 14408298 (+) True XLOC_027208
TCONS_00057672 lncRNA upstream 742610 14185166 ~ 14188729 (+) True XLOC_027205
TCONS_00053604 lncRNA upstream 754938 14174367 ~ 14176401 (+) True XLOC_027204
TCONS_00053627 lncRNA downstream 74724 15006266 ~ 15008181 (+) True XLOC_027221
TCONS_00057674 lncRNA downstream 139932 15071474 ~ 15076052 (+) False XLOC_027223
TCONS_00057675 lncRNA downstream 173152 15104694 ~ 15114467 (+) True XLOC_027224
TCONS_00057676 lncRNA downstream 251963 15183505 ~ 15240713 (+) False XLOC_027225
TCONS_00057677 lncRNA downstream 275878 15207420 ~ 15240713 (+) False XLOC_027225
TCONS_00053618 mRNA upstream 20953 14899720 ~ 14910386 (+) False XLOC_027216
TCONS_00053619 mRNA upstream 24823 14900042 ~ 14906516 (+) True XLOC_027216
TCONS_00053617 mRNA upstream 67829 14826299 ~ 14863510 (+) True XLOC_027215
TCONS_00053615 mRNA upstream 194237 14727212 ~ 14737102 (+) True XLOC_027212
TCONS_00053613 mRNA upstream 194739 14727018 ~ 14736600 (+) False XLOC_027212
TCONS_00053621 mRNA downstream 25818 14957360 ~ 14968073 (+) False XLOC_027218
TCONS_00053622 mRNA downstream 25875 14957417 ~ 14968641 (+) False XLOC_027218
TCONS_00053623 mRNA downstream 25926 14957468 ~ 14967633 (+) True XLOC_027218
TCONS_00053624 mRNA downstream 39697 14971239 ~ 14979937 (+) True XLOC_027219
TCONS_00053625 mRNA downstream 50312 14981854 ~ 14990926 (+) True XLOC_027220
TCONS_00053616 other upstream 198216 14732983 ~ 14733123 (+) True XLOC_027213
TCONS_00053612 other upstream 206125 14725074 ~ 14725214 (+) True XLOC_027211
TCONS_00053603 other upstream 811780 14116366 ~ 14119559 (+) False XLOC_027201
TCONS_00053602 other upstream 822529 14106511 ~ 14108810 (+) False XLOC_027200
TCONS_00053579 other upstream 1346758 13584483 ~ 13584581 (+) True XLOC_027191
TCONS_00053629 other downstream 143024 15074566 ~ 15074663 (+) False XLOC_027223
TCONS_00053630 other downstream 143173 15074715 ~ 15074824 (+) False XLOC_027223
TCONS_00053631 other downstream 144123 15075665 ~ 15075732 (+) True XLOC_027223
TCONS_00053633 other downstream 287702 15219244 ~ 15220667 (+) True XLOC_027225
TCONS_00053646 other downstream 1056845 15988387 ~ 15991090 (+) True XLOC_027234

Expression Profile

//