RNA id: TCONS_00053629


Basic Information

Item Value
RNA id TCONS_00053629
length 98
RNA type miRNA
GC content 0.45
exon number 1
gene id XLOC_027223
representative False

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 15071474 ~ 15076052 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GACTCCTGTTCTGTGTATGGCACTGGTAGAATTCACTGTGAAAGCACACTATCAGTGAATTACCAAAGGGCCATAAACAGAGCAGAGAAAGAACCACG

Function

GO:

id name namespace
GO:0048731 system development biological_process
GO:0050877 nervous system process biological_process
GO:0043010 camera-type eye development biological_process
GO:0048513 animal organ development biological_process
GO:0007275 multicellular organism development biological_process
GO:0050953 sensory perception of light stimulus biological_process
GO:0002088 lens development in camera-type eye biological_process
GO:0048856 anatomical structure development biological_process
GO:0007600 sensory perception biological_process
GO:0007601 visual perception biological_process
GO:0048880 sensory system development biological_process
GO:0003008 system process biological_process
GO:0032501 multicellular organismal process biological_process
GO:0032502 developmental process biological_process
GO:0001654 eye development biological_process
GO:0007423 sensory organ development biological_process
GO:0150063 visual system development biological_process
GO:0005198 structural molecule activity molecular_function
GO:0005212 structural constituent of eye lens molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000116015

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00053627 lncRNA upstream 66385 15006266 ~ 15008181 (+) True XLOC_027221
TCONS_00057138 lncRNA upstream 143024 14931339 ~ 14931542 (+) True XLOC_027217
TCONS_00057673 lncRNA upstream 303981 14767982 ~ 14770585 (+) True XLOC_027214
TCONS_00053614 lncRNA upstream 340283 14727071 ~ 14734283 (+) False XLOC_027212
TCONS_00053607 lncRNA upstream 666268 14399472 ~ 14408298 (+) True XLOC_027208
TCONS_00057675 lncRNA downstream 30031 15104694 ~ 15114467 (+) True XLOC_027224
TCONS_00057676 lncRNA downstream 108842 15183505 ~ 15240713 (+) False XLOC_027225
TCONS_00057677 lncRNA downstream 132757 15207420 ~ 15240713 (+) False XLOC_027225
TCONS_00057678 lncRNA downstream 132768 15207431 ~ 15240713 (+) False XLOC_027225
TCONS_00053632 lncRNA downstream 132770 15207433 ~ 15220977 (+) False XLOC_027225
TCONS_00053628 mRNA upstream 14690 15011341 ~ 15059876 (+) True XLOC_027222
TCONS_00053626 mRNA upstream 63675 15006217 ~ 15010891 (+) False XLOC_027221
TCONS_00053625 mRNA upstream 83640 14981854 ~ 14990926 (+) True XLOC_027220
TCONS_00053624 mRNA upstream 94629 14971239 ~ 14979937 (+) True XLOC_027219
TCONS_00053622 mRNA upstream 105925 14957417 ~ 14968641 (+) False XLOC_027218
TCONS_00053634 mRNA downstream 531181 15605844 ~ 15659524 (+) False XLOC_027226
TCONS_00053635 mRNA downstream 531181 15605844 ~ 15816540 (+) True XLOC_027226
TCONS_00053636 mRNA downstream 745065 15819728 ~ 15840799 (+) True XLOC_027227
TCONS_00053637 mRNA downstream 814774 15889437 ~ 15940249 (+) False XLOC_027229
TCONS_00053638 mRNA downstream 814776 15889439 ~ 15966260 (+) False XLOC_027229
TCONS_00053616 other upstream 341443 14732983 ~ 14733123 (+) True XLOC_027213
TCONS_00053612 other upstream 349352 14725074 ~ 14725214 (+) True XLOC_027211
TCONS_00053603 other upstream 955007 14116366 ~ 14119559 (+) False XLOC_027201
TCONS_00053602 other upstream 965756 14106511 ~ 14108810 (+) False XLOC_027200
TCONS_00053579 other upstream 1489985 13584483 ~ 13584581 (+) True XLOC_027191
TCONS_00053630 other downstream 52 15074715 ~ 15074824 (+) False XLOC_027223
TCONS_00053631 other downstream 1002 15075665 ~ 15075732 (+) True XLOC_027223
TCONS_00053633 other downstream 144581 15219244 ~ 15220667 (+) True XLOC_027225
TCONS_00053646 other downstream 913724 15988387 ~ 15991090 (+) True XLOC_027234
TCONS_00053651 other downstream 976937 16051600 ~ 16055777 (+) False XLOC_027237