RNA id: TU2209625



Basic Information


Item Value
RNA id TU2209625
length 218
lncRNA type inter_gene
GC content 0.41
exon number 2
gene id G1931691
representative True

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 40359463 ~ 40362079 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATCATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCACGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCACGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCATGATCAGTGTCTCTTTCTGATAGGTCCCCATTATACATCACGATCATTCT

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU2209564 lncRNA upstream 79824 40280037 ~ 40280244 (+) True G1931638
TU2209475 lncRNA upstream 166208 40193641 ~ 40193860 (+) True G1931550
TU2209473 lncRNA upstream 166639 40193006 ~ 40193429 (+) True G1931548
TU2209470 lncRNA upstream 167140 40191887 ~ 40192928 (+) True G1931546
TU2209469 lncRNA upstream 169014 40190449 ~ 40191054 (+) True G1931545
TU2209635 lncRNA downstream 1378 40363023 ~ 40363385 (+) True G1931698
TU2209699 lncRNA downstream 73985 40435630 ~ 40435853 (+) True G1931754
TU2209750 lncRNA downstream 100265 40461910 ~ 40462122 (+) True G1931778
TU2209761 lncRNA downstream 108237 40469882 ~ 40470094 (+) True G1931789
TU2209762 lncRNA downstream 108781 40470426 ~ 40470679 (+) True G1931790
XM_021581565.2 mRNA upstream 550320 39800737 ~ 39809748 (+) False LOC110503199
XR_005039391.1 mRNA upstream 550320 39800737 ~ 39809748 (+) False LOC110503199
XM_021581566.2 mRNA upstream 550320 39803778 ~ 39809748 (+) True LOC110503199
trnat-agu-148 mRNA upstream 595336 39764659 ~ 39764732 (+) True trnat-agu-148
XR_005039426.1 mRNA upstream 727689 39630663 ~ 39632379 (+) False LOC110503201
LOC110503406 mRNA downstream 82125 40443770 ~ 40535727 (+) False LOC110503406
XM_036961742.1 mRNA downstream 448533 40810178 ~ 40837432 (+) False LOC110503211
XM_021581580.2 mRNA downstream 448533 40810178 ~ 40837501 (+) False LOC110503211
XM_036961741.1 mRNA downstream 451182 40812827 ~ 40837501 (+) True LOC110503211
XM_021581568.2 mRNA downstream 600797 40962442 ~ 40972379 (+) False LOC110503202
TU2207278 other upstream 254536 40089400 ~ 40105532 (+) False G1929916
TU2207269 other upstream 281736 40076476 ~ 40078332 (+) True G1929909
TU2207252 other upstream 307718 40049364 ~ 40052350 (+) False G1929901
TU2207202 other upstream 331551 40025935 ~ 40028517 (+) False G1929891
TU2209850 other downstream 199567 40561212 ~ 40561906 (+) True G1931869
TU2210387 other downstream 752992 41114637 ~ 41117412 (+) True G1932319
TU2210655 other downstream 968405 41330050 ~ 41338188 (+) True G1932564
TU2211289 other downstream 1933203 42294848 ~ 42335194 (+) False LOC110503413
TU2211428 other downstream 1999611 42361256 ~ 42365260 (+) True G1933231

Expression Profile


TU2209625 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU2209625 Expression in each Bioproject

Bar chart with 5 bars.
TU2209625 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.