RNA id: TU2209756



Basic Information


Item Value
RNA id TU2209756
length 413
lncRNA type intronic
GC content 0.39
exon number 1
gene id G1931784
representative True

Chromosome Information


Item Value
chromosome id NC_048588.1
NCBI id CM023242.2
chromosome length 45930806
location 40463789 ~ 40464201 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ccaaaaccatatttataattgcagtctcttgtacatctgtaaacaagcgtcctcgtcctccatgatgtctttgcctttccactctgtacagaattcaaacacagtatgtgttcagcataggaactgtaaacaatgtacaaaatgtagtacagcatgataaccaacctcattcattcaatgcagtgcagtaaatggatggcttagagttacaaatgtttatgcaatactatgcagtcatacgtattttacagtacattactgtaatgctaaaatagtcattagatagttgcatacctgttctcatttctgaaggttcgaattatggacgccactgtaaatcgactcaagttggtctggactctcagtccagcctctctcatggtcaaaccgtggttgatcacatgatcaacaag

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU2209752 lncRNA downstream 1620 40461758 ~ 40462169 (-) True G1931780
TU2209738 lncRNA downstream 12333 40451065 ~ 40451456 (-) False G1931771
TU2209740 lncRNA downstream 12333 40451065 ~ 40451456 (-) False G1931771
TU2209736 lncRNA downstream 12381 40451065 ~ 40451408 (-) False G1931771
TU2209768 lncRNA upstream 8060 40472261 ~ 40472700 (-) True G1931796
TU2209770 lncRNA upstream 8822 40473023 ~ 40473313 (-) True G1931798
TU2209771 lncRNA upstream 11601 40475802 ~ 40476062 (-) True G1931799
TU2209782 lncRNA upstream 23706 40487907 ~ 40488173 (-) True G1931810
TU2209784 lncRNA upstream 24115 40488316 ~ 40488542 (-) True G1931812
XM_036961568.1 mRNA downstream 83309 40370210 ~ 40380480 (-) False LOC118944043
XM_036961991.1 mRNA downstream 341884 40027973 ~ 40121905 (-) False LOC110503403
XM_036961988.1 mRNA downstream 341886 40027973 ~ 40121903 (-) False LOC110503403
XM_036961989.1 mRNA downstream 341892 40027973 ~ 40121897 (-) False LOC110503403
XR_005039403.1 mRNA downstream 438628 40023797 ~ 40025161 (-) True LOC118944096
XM_036961570.1 mRNA upstream 898341 41362542 ~ 41375708 (-) True LOC118944045
XM_036961521.1 mRNA upstream 1312755 41776956 ~ 41865547 (-) False zbbx
XM_036961523.1 mRNA upstream 1312755 41776956 ~ 41865547 (-) True zbbx
XM_036961134.1 mRNA upstream 1524522 41988723 ~ 42023198 (-) False LOC118944009
XM_036961131.1 mRNA upstream 1546077 42010278 ~ 42023232 (-) False LOC118944009
TU2208958 other downstream 1113150 39331834 ~ 39350639 (-) True G1931133
TU2208702 other downstream 1376786 39085575 ~ 39087003 (-) True dhx34
TU2208705 other downstream 1388656 39074316 ~ 39075133 (-) False dhx34
TU2208725 other downstream 1483809 38976417 ~ 38979980 (-) False G1930981
TU2209757 other upstream 1419 40465620 ~ 40465867 (-) True G1931785
TU2210500 other upstream 692170 41156371 ~ 41156733 (-) True G1932422
TU2211565 other upstream 1524636 41988837 ~ 42003428 (-) True LOC118944009
TU2211644 other upstream 1608926 42073127 ~ 42075939 (-) True G1933401
TU2211802 other upstream 1935696 42399897 ~ 42400327 (-) True G1933529

Expression Profile


TU2209756 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU2209756 Expression in each Bioproject

Bar chart with 20 bars.
TU2209756 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.