RNA id: TU2246307



Basic Information


Item Value
RNA id TU2246307
length 531
RNA type TUCP
GC content 0.51
exon number 1
gene id G1964592
representative True

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 23221973 ~ 23222503 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gtcgttaagacactaacagcttacagacggtaggcaattaaggtcacagttgtgaaaacttaggacactaaagaggcctttctactgacgctgaaaaacaccaaaagaaagatgcccagggtccctgctcatctgcgtgaatgtgcgttaggcatgctgcaaggaggcatgaggactgcagatgtggccagggcaataaattgcaatgtctgtactgtgagatgcctaagacagcgctacagggagacaggacggacagctgatcgtcctcgcagtggcagaccacgtgtaacaacacctgcacatgatctgtacatccgaacatcacacctgtgggacaggtacaggatggcaacaacaactgcccgagttacaccaggaatgcacaattcctccatcagtaacaagactgtccacaataggctgagagaggctggactgagggcttgtaggcctgttgtaaggcagatcctcaccagacatcactggcaacaacgttgccaatgtgcacaaacccaccgttgcttgacc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU2246239 lncRNA downstream 34301 23183295 ~ 23187672 (-) True G1964526
TU2246270 lncRNA downstream 49788 23171991 ~ 23172185 (-) True G1964557
TU2246269 lncRNA downstream 50295 23171291 ~ 23171678 (-) True G1964556
TU2246261 lncRNA downstream 76422 23145187 ~ 23145551 (-) True G1964548
TU2246254 lncRNA downstream 88466 23132958 ~ 23133507 (-) True G1964541
TU2246311 lncRNA upstream 4670 23227173 ~ 23227378 (-) True G1964596
TU2246315 lncRNA upstream 10517 23233020 ~ 23233510 (-) True G1964600
TU2246322 lncRNA upstream 18528 23241031 ~ 23241251 (-) True G1964607
TU2246326 lncRNA upstream 30086 23252589 ~ 23252845 (-) True G1964611
TU2246330 lncRNA upstream 32334 23254837 ~ 23255044 (-) True G1964615
XM_036962825.1 mRNA downstream 83813 23106380 ~ 23138160 (-) False LOC110505636
XM_036962826.1 mRNA downstream 83813 23106380 ~ 23138160 (-) True LOC110505636
XM_036962828.1 mRNA downstream 84952 23106379 ~ 23137021 (-) False LOC110505636
XM_036962827.1 mRNA downstream 93723 23106379 ~ 23128250 (-) False LOC110505636
XM_036962978.1 mRNA downstream 267024 22925846 ~ 22954949 (-) True LOC110504210
XM_021584989.2 mRNA upstream 45041 23267544 ~ 23331888 (-) False brf1a
XM_036962240.1 mRNA upstream 45041 23267544 ~ 23331891 (-) True brf1a
XM_036962697.1 mRNA upstream 121900 23344403 ~ 23353979 (-) False LOC110505641
XM_036962698.1 mRNA upstream 121900 23344403 ~ 23353991 (-) False LOC110505641
XM_036962695.1 mRNA upstream 121900 23344403 ~ 23353992 (-) False LOC110505641
TU2246278 other downstream 53860 23165032 ~ 23168113 (-) True G1964564
TU2245462 other downstream 176269 23036891 ~ 23045704 (-) True G1963846
TU2244298 other downstream 1125477 22095519 ~ 22096496 (-) True G1962803
TU2243996 other downstream 1224403 21990844 ~ 21997570 (-) False G1962524
TU2244181 other downstream 1335038 21876057 ~ 21886935 (-) True G1962691
TU2246459 other upstream 203060 23425563 ~ 23428644 (-) False G1964728
TU2249876 other upstream 3312861 26535364 ~ 26538708 (-) True G1967882
TU2250152 other upstream 3494181 26716684 ~ 26765371 (-) True LOC110505716
TU2251892 other upstream 4877418 28099921 ~ 28101436 (-) True G1969699
TU2251917 other upstream 4920935 28143438 ~ 28143762 (-) True G1969724

Expression Profile


TU2246307 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

TU2246307 Expression in each Bioproject

Bar chart with 21 bars.
TU2246307 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.