RNA id: TU2252826



Basic Information


Item Value
RNA id TU2252826
length 388
RNA type TUCP
GC content 0.44
exon number 2
gene id G1970606
representative True

Chromosome Information


Item Value
chromosome id NC_048589.1
NCBI id CM023243.3
chromosome length 47542702
location 28857940 ~ 28861987 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


catcatgaagaacaaggaacactccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctttccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaag

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU2252804 lncRNA downstream 10621 28846845 ~ 28847319 (-) True G1970585
TU2252700 lncRNA downstream 78274 28779433 ~ 28779666 (-) True G1970482
TU2252687 lncRNA downstream 86837 28770875 ~ 28771103 (-) True G1970469
TU2252430 lncRNA downstream 310646 28547071 ~ 28547294 (-) True G1970219
TU2252428 lncRNA downstream 311066 28546251 ~ 28546874 (-) False G1970219
TU2252910 lncRNA upstream 521 28862508 ~ 28862929 (-) True G1970683
TU2252913 lncRNA upstream 1170 28863157 ~ 28925758 (-) True G1970684
TU2252918 lncRNA upstream 6680 28868667 ~ 28869177 (-) True G1970687
TU2252993 lncRNA upstream 122775 28984762 ~ 28985097 (-) True G1970760
TU2253010 lncRNA upstream 133405 28995392 ~ 28995724 (-) True G1970777
XM_021585144.2 mRNA downstream 763705 28066100 ~ 28094235 (-) True ctage5
XM_036963130.1 mRNA downstream 763706 28066100 ~ 28094234 (-) False ctage5
XM_036963131.1 mRNA downstream 763706 28066100 ~ 28094234 (-) False ctage5
XM_036963132.1 mRNA downstream 763706 28066100 ~ 28094234 (-) False ctage5
XM_036963134.1 mRNA downstream 763707 28066100 ~ 28094233 (-) False ctage5
XM_021585158.2 mRNA upstream 251628 29113615 ~ 29122177 (-) False LOC110505745
XM_036962820.1 mRNA upstream 251628 29113615 ~ 29122177 (-) False LOC110505745
XM_036962821.1 mRNA upstream 251628 29113615 ~ 29122177 (-) True LOC110505745
XM_036962824.1 mRNA upstream 273374 29135361 ~ 29169633 (-) False daam1a
XM_036962822.1 mRNA upstream 273374 29135361 ~ 29191453 (-) False daam1a
TU2251917 other downstream 714178 28143438 ~ 28143762 (-) True G1969724
TU2251892 other downstream 756504 28099921 ~ 28101436 (-) True G1969699
TU2250152 other downstream 2092569 26716684 ~ 26765371 (-) True LOC110505716
TU2249876 other downstream 2319232 26535364 ~ 26538708 (-) True G1967882
TU2246459 other downstream 5429296 23425563 ~ 23428644 (-) False G1964728
TU2253707 other upstream 660773 29522760 ~ 29525046 (-) True G1971357
TU2254903 other upstream 1120297 29982284 ~ 29982900 (-) True G1972454
TU2255230 other upstream 1645564 30507551 ~ 30508058 (-) True G1972746
TU2255304 other upstream 1754601 30616588 ~ 30675515 (-) False G1972810
TU2255302 other upstream 1764102 30626089 ~ 30683403 (-) False G1972810

Expression Profile


TU2252826 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

TU2252826 Expression in each Bioproject

Bar chart with 20 bars.
TU2252826 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.