RNA id: TU2283109



Basic Information


Item Value
RNA id TU2283109
length 366
RNA type TUCP
GC content 0.56
exon number 1
gene id G1994757
representative True

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 9390568 ~ 9390933 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cccaaagaaatgccaccccacaccatgactgacccaccgccaaaccggtcatgctggaggatgttgcaggcagcagaacgttctccacggcgtctccagactctgtcacatctgtcacgtgctcagtgtgaacctgctttcatctgtgaagagcacagggcgccagtggtgaatttgccaatcttggtgttctctggcaaatgccaaacgtcctgcacggtgttgggctgtaagcacaacccccacctgtggacgtcgggccctcataccaccctcatggagtctgtttctgaccgtttgagcagacacatgcacatttgtggcctgctggaggtcattttgcagggctctggcagtgctcctcct

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU2283108 lncRNA upstream 152 9390083 ~ 9390416 (+) True G1994756
TU2283105 lncRNA upstream 2757 9387481 ~ 9387811 (+) True G1994753
TU2282038 lncRNA upstream 7118 9383147 ~ 9383450 (+) True G1994050
TU2281983 lncRNA upstream 126942 9260870 ~ 9263626 (+) True G1994006
TU2281988 lncRNA upstream 130007 9258783 ~ 9260561 (+) False G1994008
TU2283115 lncRNA downstream 496 9391429 ~ 9391681 (+) True G1994760
TU2283113 lncRNA downstream 1131 9392064 ~ 9394438 (+) True G1994759
TU2283128 lncRNA downstream 30526 9421459 ~ 9421764 (+) True G1994773
TU2283134 lncRNA downstream 40829 9431762 ~ 9432054 (+) True G1994779
TU2283152 lncRNA downstream 80028 9470961 ~ 9471435 (+) True G1994797
XM_036963550.1 mRNA upstream 156565 9173028 ~ 9234003 (+) True klf13
XM_036963210.1 mRNA upstream 375081 8982115 ~ 9015487 (+) True LOC118936595
XM_036963208.1 mRNA upstream 408945 8964942 ~ 8981623 (+) False LOC118944396
XM_036963209.1 mRNA upstream 408945 8964953 ~ 8981623 (+) True LOC118944396
XM_036964330.1 mRNA upstream 497408 8880465 ~ 8893160 (+) True LOC118944518
XM_021608052.2 mRNA downstream 149353 9540286 ~ 9543273 (+) True LOC110526863
XM_036964412.1 mRNA downstream 316521 9707454 ~ 9812098 (+) False si:ch211-266g18.10
XM_036964413.1 mRNA downstream 316521 9707454 ~ 9812098 (+) False si:ch211-266g18.10
XM_036964414.1 mRNA downstream 316521 9707454 ~ 9812098 (+) False si:ch211-266g18.10
XM_036964415.1 mRNA downstream 316521 9707454 ~ 9812098 (+) False si:ch211-266g18.10
TU2281693 other upstream 692445 8697174 ~ 8698123 (+) True G1993783
TU2281675 other upstream 722301 8666601 ~ 8668267 (+) True G1993771
TU2281607 other upstream 839201 8537939 ~ 8551367 (+) True LOC110512379
TU2281425 other upstream 1242069 8143752 ~ 8148499 (+) False G1993593
TU2281371 other upstream 1348547 8038186 ~ 8042021 (+) True G1993550
TU2283219 other downstream 174110 9565043 ~ 9566154 (+) True G1994851
TU2287233 other downstream 3831104 13222037 ~ 13222681 (+) True G1998628
TU2291409 other downstream 6298835 15689768 ~ 15696280 (+) True G2002614
TU2291393 other downstream 6404199 15795132 ~ 15800073 (+) False LOC110506284
TU2291396 other downstream 6404723 15795656 ~ 15800073 (+) False LOC110506284

Expression Profile


TU2283109 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

TU2283109 Expression in each Bioproject

Bar chart with 21 bars.
TU2283109 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.