RNA id: TU2324698



Basic Information


Item Value
RNA id TU2324698
length 218
lncRNA type inter_gene
GC content 0.31
exon number 1
gene id G2032333
representative True

Chromosome Information


Item Value
chromosome id NC_048590.1
NCBI id CM023244.2
chromosome length 51113553
location 43804719 ~ 43804936 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


aacaaattcaatcccttttagacaatttcctgggtaaaacattccgctgtaatagtgaaggtgtaaacttggcagtagaaaatcttaacagtatatttgacctctcagcttccctatcaaatctaaaaatctcaaatagaaaaccgaaaaaaattaacaataatgacaaatggtttgatgaagaatgcaaaaatctaagaaagaaattgagaaacctg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU2324683 lncRNA downstream 12680 43791528 ~ 43792039 (-) True G2032318
TU2324675 lncRNA downstream 17538 43786374 ~ 43787181 (-) False G2032313
TU2324674 lncRNA downstream 17664 43786374 ~ 43787055 (-) False G2032313
TU2324676 lncRNA downstream 17664 43786374 ~ 43787055 (-) True G2032313
TU2324671 lncRNA downstream 24368 43777913 ~ 43780351 (-) True G2032310
TU2324700 lncRNA upstream 165 43805101 ~ 43805630 (-) True G2032335
TU2324703 lncRNA upstream 2450 43807386 ~ 43807769 (-) True G2032338
TU2324704 lncRNA upstream 3002 43807938 ~ 43808423 (-) True G2032339
TU2324736 lncRNA upstream 37584 43842520 ~ 43842820 (-) True G2032369
TU2324754 lncRNA upstream 50226 43855162 ~ 43856760 (-) True G2032380
LOC118944426 mRNA downstream 11866 43780930 ~ 43792853 (-) True LOC118944426
XM_036963200.1 mRNA downstream 365523 43428658 ~ 43439196 (-) True LOC110506867
XM_036963798.1 mRNA downstream 606542 43180007 ~ 43198177 (-) False LOC110506858
XM_036963628.1 mRNA downstream 641707 43161768 ~ 43163012 (-) True LOC118944425
XM_036963627.1 mRNA downstream 817437 42964294 ~ 42987282 (-) True LOC110526985
XM_036963442.1 mRNA upstream 91079 43896015 ~ 43949012 (-) False LOC110526988
XM_036963439.1 mRNA upstream 94475 43899411 ~ 43949007 (-) False LOC110526988
XM_036963441.1 mRNA upstream 94475 43899411 ~ 43949011 (-) False LOC110526988
XM_036963438.1 mRNA upstream 94475 43899411 ~ 43949012 (-) False LOC110526988
XM_036963440.1 mRNA upstream 94475 43899411 ~ 43949012 (-) False LOC110526988
TU2324491 other downstream 234665 43569160 ~ 43570054 (-) True G2032150
TU2324286 other downstream 606891 43191698 ~ 43197828 (-) True LOC110506858
TU2324292 other downstream 618995 43184636 ~ 43185724 (-) True G2031974
TU2323769 other downstream 1183173 42616244 ~ 42621546 (-) True LOC110513924
TU2323493 other downstream 1245816 42557797 ~ 42558903 (-) True G2031343
TU2324940 other upstream 74257 43879193 ~ 43881732 (-) True G2032544
TU2324949 other upstream 94564 43899500 ~ 43905240 (-) False LOC110526988
TU2325823 other upstream 1048917 44853853 ~ 44923017 (-) True LOC110506903
TU2325845 other upstream 1134302 44939238 ~ 44956893 (-) True LOC110506178
TU2326479 other upstream 1534161 45339097 ~ 45358692 (-) True LOC110506182

Expression Profile


TU2324698 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU2324698 Expression in each Bioproject

Bar chart with 10 bars.
TU2324698 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.