RNA id: TCONS_00005215


Basic Information

Item Value
RNA id TCONS_00005215
length 392
RNA type mRNA
GC content 0.47
exon number 3
gene id XLOC_002814
representative True

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 27006266 ~ 27009584 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTGACCTAGCTTTTCCCCGCGATCCTTTATAGATTAGGGAAAGTTAGTTTTGCACATATTTCGTGCAGATCATGAGCGGCATGAGGATCCTCACGGGCTCCGTCGCGCTGGGCGGACTCACATACGCCATATGGATCATATTTTCCCCTGGAGAGGAGAGGAAAAAGGAGATATTAAAGTTTCATAACAGATGCTGCGCATGTGCTCGTGTTCAAGGAGCGAATATAGAGAGTCTACCTGAAGCCAATCCAGTCCGAATGGAAGAGACCAGGAAAAGAAATGCCATCATGCTTCAGGTTTTAAAGGATGCTGCAGAGACCAATGATAACATTGCACGTGGATTTGGGAGCCAGAAATGATGGAACCAGATATCACAATCATGATGGGGAGAG

Function

GO:

id name namespace
GO:0042407 cristae formation biological_process
GO:0006122 mitochondrial electron transport, ubiquinol to cytochrome c biological_process
GO:0034551 mitochondrial respiratory chain complex III assembly biological_process
GO:0006754 ATP biosynthetic process biological_process
GO:0005743 mitochondrial inner membrane cellular_component
GO:0005750 mitochondrial respiratory chain complex III cellular_component
GO:0031305 integral component of mitochondrial inner membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005739 mitochondrion cellular_component
GO:0070300 phosphatidic acid binding molecular_function
GO:1901612 cardiolipin binding molecular_function

KEGG:

id description
ko03029 Mitochondrial biogenesis

ZFIN:

id description
ZDB-GENE-030131-8451 Predicted to enable cardiolipin binding activity and phosphatidic acid binding activity. Predicted to be involved in cristae formation; mitochondrial electron transport, ubiquinol to cytochrome c; and mitochondrial respiratory chain complex III assembly. Predicted to act upstream of or within ATP biosynthetic process. Predicted to be located in mitochondrion. Predicted to be integral component of mitochondrial inner membrane. Human ortholog(s) of this gene implicated in mitochondrial complex III deficiency nuclear type 9. Orthologous to human UQCC3 (ubiquinol-cytochrome c reductase complex assembly factor 3).

Ensembl:

ensembl_id ENSDART00000139942

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00006061 lncRNA downstream 3957 27000562 ~ 27002614 (-) False XLOC_002813
TCONS_00006060 lncRNA downstream 3957 27000562 ~ 27002614 (-) True XLOC_002813
TCONS_00005211 lncRNA downstream 4167 27000562 ~ 27002404 (-) False XLOC_002813
TCONS_00006059 lncRNA downstream 7075 26991809 ~ 26999496 (-) False XLOC_002812
TCONS_00006058 lncRNA downstream 104266 26901272 ~ 26902305 (-) True XLOC_002809
TCONS_00006063 lncRNA upstream 148524 27157937 ~ 27162145 (-) False XLOC_002816
TCONS_00006062 lncRNA upstream 148524 27157937 ~ 27162145 (-) True XLOC_002816
TCONS_00006064 lncRNA upstream 1188503 28197916 ~ 28202821 (-) False XLOC_002823
TCONS_00006065 lncRNA upstream 1188503 28197916 ~ 28267126 (-) False XLOC_002823
TCONS_00006067 lncRNA upstream 1188503 28197916 ~ 28291300 (-) False XLOC_002823
TCONS_00005210 mRNA downstream 7089 26998414 ~ 26999482 (-) True XLOC_002812
TCONS_00005209 mRNA downstream 9227 26991805 ~ 26997344 (-) False XLOC_002812
TCONS_00005208 mRNA downstream 16696 26987108 ~ 26989875 (-) True XLOC_002811
TCONS_00005207 mRNA downstream 21340 26982254 ~ 26985231 (-) True XLOC_002810
TCONS_00005205 mRNA downstream 213123 26771047 ~ 26793448 (-) True XLOC_002806
TCONS_00005216 mRNA upstream 18606 27028019 ~ 27049170 (-) False XLOC_002815
TCONS_00005217 mRNA upstream 18630 27028043 ~ 27046639 (-) True XLOC_002815
TCONS_00005219 mRNA upstream 173291 27182704 ~ 27197044 (-) False XLOC_002818
TCONS_00005220 mRNA upstream 173969 27183382 ~ 27566481 (-) False XLOC_002818
TCONS_00005221 mRNA upstream 174344 27183757 ~ 27223827 (-) False XLOC_002818
TCONS_00005203 other downstream 262440 26743596 ~ 26744131 (-) True XLOC_002804
TCONS_00005187 other downstream 804048 26196284 ~ 26202523 (-) False XLOC_002800
TCONS_00005183 other downstream 865490 26132469 ~ 26141081 (-) False XLOC_002799
TCONS_00005164 other downstream 1507097 25494173 ~ 25499474 (-) True XLOC_002790
TCONS_00005133 other downstream 2550839 24455616 ~ 24455732 (-) True XLOC_002771
TCONS_00005218 other upstream 160543 27169956 ~ 27170072 (-) True XLOC_002817
TCONS_00005228 other upstream 404833 27414246 ~ 27414362 (-) True XLOC_002819
TCONS_00005237 other upstream 1189481 28198894 ~ 28199041 (-) False XLOC_002823
TCONS_00005238 other upstream 1283430 28292843 ~ 28292959 (-) True XLOC_002825
TCONS_00005248 other upstream 1361796 28371209 ~ 28372485 (-) True XLOC_002827

Expression Profile

//