RNA id: TCONS_00055238


Basic Information

Item Value
RNA id TCONS_00055238
length 471
RNA type mRNA
GC content 0.50
exon number 5
gene id XLOC_028460
representative False

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 4930406 ~ 4932619 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCCGCAGACGTCACACTCCGGCGACGGAAGTTGAGTCTGTCAGTCGCAGAAATGGCTGGATTGCTCAAAAAGACCACAGGTTTGGTTGGCCTCGCTGTGAGCCAGAATCCACACGAGCGTCTGGGAAATCTGTACGTGAAGATCCTGTCATGTCTGCAGAGGATTCCCCAGGACGCCGCTTACAGAAAATACACTGAACAACTGATCAGCGAGAGGTTCAACCACGTCAAAACTGAGCCAGACGTTGGGAAGCTGGAGAAGAAAATCAACGCTGGACAGATCGAGGAGGTTATTGCACAGGCTGAAGCGGAGCTCTCGCTGTCCAGAAAGATGGTGGAATGGAAAGCCTGGGAGCCGCTCATTGAAGAAGCTCCAGCTAACCAGTGGAAATGGCCCATCTGAAGCCCTCTTCACTCGCATGCATGTAGATTATGTTTATATTCAGGAATAAATCAACTCCGTCTATTTAAA

Function

GO:

id name namespace
GO:0022904 respiratory electron transport chain biological_process
GO:0005747 mitochondrial respiratory chain complex I cellular_component
GO:0008137 NADH dehydrogenase (ubiquinone) activity molecular_function

KEGG:

id description
ko00190 Oxidative phosphorylation
ko04723 Retrograde endocannabinoid signaling
ko04714 Thermogenesis
ko05208 Chemical carcinogenesis - reactive oxygen species
ko05010 Alzheimer disease
ko05012 Parkinson disease
ko05014 Amyotrophic lateral sclerosis
ko05016 Huntington disease
ko05020 Prion disease
ko05022 Pathways of neurodegeneration - multiple diseases
ko05415 Diabetic cardiomyopathy
ko04932 Non-alcoholic fatty liver disease

ZFIN:

id description
ZDB-GENE-050320-17 Predicted to be involved in respiratory electron transport chain. Predicted to be located in mitochondrial inner membrane. Predicted to be part of mitochondrial respiratory chain complex I. Orthologous to human NDUFA5 (NADH:ubiquinone oxidoreductase subunit A5).

Ensembl:

ensembl_id ENSDART00000103293

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00055221 lncRNA downstream 413898 4514438 ~ 4516508 (-) True XLOC_028450
TCONS_00055216 lncRNA downstream 555702 4321168 ~ 4374704 (-) True XLOC_028446
TCONS_00055214 lncRNA downstream 674131 4238000 ~ 4256275 (-) False XLOC_028445
TCONS_00055208 lncRNA downstream 701251 4224273 ~ 4229155 (-) True XLOC_028443
TCONS_00058005 lncRNA downstream 701338 4220148 ~ 4229068 (-) False XLOC_028443
TCONS_00058006 lncRNA upstream 7848 4940467 ~ 4962892 (-) False XLOC_028461
TCONS_00057318 lncRNA upstream 23333 4955952 ~ 4961841 (-) True XLOC_028461
TCONS_00058009 lncRNA upstream 30338 4962957 ~ 4966824 (-) False XLOC_028462
TCONS_00058011 lncRNA upstream 30338 4962957 ~ 4966824 (-) False XLOC_028462
TCONS_00058013 lncRNA upstream 30338 4962957 ~ 4966824 (-) False XLOC_028462
TCONS_00055236 mRNA downstream 95789 4832144 ~ 4834617 (-) False XLOC_028459
TCONS_00055237 mRNA downstream 96059 4832150 ~ 4834347 (-) True XLOC_028459
TCONS_00055235 mRNA downstream 135201 4782721 ~ 4795205 (-) True XLOC_028458
TCONS_00055233 mRNA downstream 149739 4758001 ~ 4780667 (-) False XLOC_028457
TCONS_00055234 mRNA downstream 149896 4758464 ~ 4780510 (-) True XLOC_028457
TCONS_00055241 mRNA upstream 38423 4971042 ~ 5019113 (-) False XLOC_028463
TCONS_00055240 mRNA upstream 38423 4971042 ~ 5019113 (-) False XLOC_028463
TCONS_00055242 mRNA upstream 38519 4971138 ~ 5018705 (-) True XLOC_028463
TCONS_00055243 mRNA upstream 93006 5025625 ~ 5092335 (-) False XLOC_028464
TCONS_00055244 mRNA upstream 109948 5042567 ~ 5077158 (-) True XLOC_028464
TCONS_00055225 other downstream 359601 4546209 ~ 4570805 (-) True XLOC_028452
TCONS_00055220 other downstream 433615 4492566 ~ 4496791 (-) True XLOC_028449
TCONS_00055185 other downstream 2244316 2675106 ~ 2686090 (-) False XLOC_028423
TCONS_00055166 other downstream 2767682 2060524 ~ 2162724 (-) False XLOC_028412
TCONS_00055131 other downstream 3981564 937229 ~ 948842 (-) True XLOC_028386
TCONS_00055263 other upstream 437437 5370056 ~ 5371622 (-) True XLOC_028470
TCONS_00055293 other upstream 1504145 6436764 ~ 6451732 (-) False XLOC_028490
TCONS_00055295 other upstream 1633034 6565653 ~ 6567266 (-) True XLOC_028490
TCONS_00055299 other upstream 2252576 7185195 ~ 7185311 (-) True XLOC_028494
TCONS_00055301 other upstream 2289461 7222080 ~ 7222367 (-) True XLOC_028496

Expression Profile

//