RNA id: TCONS_00055263


Basic Information

Item Value
RNA id TCONS_00055263
length 701
RNA type nonsense_mediated_decay
GC content 0.43
exon number 5
gene id XLOC_028470
representative True

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 5362909 ~ 5371639 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CGGCTACTTCCGGTTTCGCGGTTGAGCGTTGTTGTTCGTTGCTTCGGTCAACTTCACGACAATCGTACACCGTCTATTATGATTTAACCAAGTGATGCGAAGCGATCAGAGGTCGACTAAAAGACAATTATAAGTTTATTCTAACATCAAATAATGGATATCCTTAACGTAGAGAGTCGAGAGCCGGCTCTCCCTCTCTCTGCCCTGCGTCTGGTTGTTCCACCTCTCCGGCTGATGTCAGCATTTCTATGGCAGGTGATTCAGCGGCGCAATGTGACACAGTACGGGAAACTGGAGCAATTTGTAAATCTGGTGACAGAGAACGTTCCAGACATCATGAGTCGGAGTCTGGTTAATAAACTAATCTTTCACATGAGAAAAAAGATTACTTTTTATTCTTTAGGTGATCCTAGAGCTTTGTCTGAAAGATAAAATGCCAGATCTGTGGATCATTCAGGCACATCTGGATTCTCTCCGAAATCTCACACACAAATGTAAAGATGTGGAAAGTGAGATCATCAATAACAAATTCATTAGAACGATGCACAGCATTTTAGAAGACACAGAAAAGAAAGAGGATTTCCTCCAGCACATATTCCCTGTAGAATATGGTTCAGGATATGATGCAGTTTTACAGAGTCTTGCATGGGAGTTTCTGTCTCGAGTGGAAGATCTGCTGCCGGTGCCCAATCTTAAAGAGG

Function

GO:

id name namespace
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0016233 telomere capping biological_process
GO:0070187 shelterin complex cellular_component
GO:0046872 metal ion binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-041210-86 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to act upstream of or within telomere capping. Predicted to be part of shelterin complex.

Ensembl:

ensembl_id ENSDART00000145474

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00055254 lncRNA downstream 87224 5282002 ~ 5282832 (-) True XLOC_028467
TCONS_00055247 lncRNA downstream 261149 5105620 ~ 5108907 (-) True XLOC_028465
TCONS_00058019 lncRNA downstream 402345 4962957 ~ 4967711 (-) True XLOC_028462
TCONS_00058018 lncRNA downstream 403085 4962957 ~ 4966971 (-) False XLOC_028462
TCONS_00058017 lncRNA downstream 403191 4962957 ~ 4966865 (-) False XLOC_028462
TCONS_00058021 lncRNA upstream 50124 5421746 ~ 5424067 (-) False XLOC_028471
TCONS_00058020 lncRNA upstream 50124 5421746 ~ 5424067 (-) False XLOC_028471
TCONS_00055265 lncRNA upstream 50124 5421746 ~ 5424183 (-) False XLOC_028471
TCONS_00055264 lncRNA upstream 50124 5421746 ~ 5424242 (-) False XLOC_028471
TCONS_00058022 lncRNA upstream 50124 5421746 ~ 5453124 (-) False XLOC_028471
TCONS_00055259 mRNA downstream 3490 5365754 ~ 5366566 (-) False XLOC_028470
TCONS_00055257 mRNA downstream 36085 5327632 ~ 5333971 (-) True XLOC_028469
TCONS_00055256 mRNA downstream 37242 5327632 ~ 5332814 (-) False XLOC_028469
TCONS_00055255 mRNA downstream 53050 5304208 ~ 5317006 (-) True XLOC_028468
TCONS_00055251 mRNA downstream 67190 5260941 ~ 5302866 (-) False XLOC_028467
TCONS_00055269 mRNA upstream 126608 5498230 ~ 5538752 (-) True XLOC_028473
TCONS_00055270 mRNA upstream 197066 5568688 ~ 5595237 (-) False XLOC_028475
TCONS_00055271 mRNA upstream 215561 5587183 ~ 5597167 (-) False XLOC_028475
TCONS_00055272 mRNA upstream 215993 5587615 ~ 5597802 (-) True XLOC_028475
TCONS_00055273 mRNA upstream 273629 5645251 ~ 5652030 (-) True XLOC_028476
TCONS_00055239 other downstream 437532 4930411 ~ 4932524 (-) True XLOC_028460
TCONS_00055225 other downstream 799251 4546209 ~ 4570805 (-) True XLOC_028452
TCONS_00055220 other downstream 873265 4492566 ~ 4496791 (-) True XLOC_028449
TCONS_00055185 other downstream 2683966 2675106 ~ 2686090 (-) False XLOC_028423
TCONS_00055166 other downstream 3207332 2060524 ~ 2162724 (-) False XLOC_028412
TCONS_00055293 other upstream 1065142 6436764 ~ 6451732 (-) False XLOC_028490
TCONS_00055295 other upstream 1194031 6565653 ~ 6567266 (-) True XLOC_028490
TCONS_00055299 other upstream 1813573 7185195 ~ 7185311 (-) True XLOC_028494
TCONS_00055301 other upstream 1850458 7222080 ~ 7222367 (-) True XLOC_028496
TCONS_00055306 other upstream 2308357 7679979 ~ 7680095 (-) True XLOC_028504

Expression Profile

//