RNA id: TCONS_00005232


Basic Information

Item Value
RNA id TCONS_00005232
length 507
RNA type mRNA
GC content 0.52
exon number 2
gene id XLOC_002820
representative True

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 27977373 ~ 28028999 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGACAGACAGTGCCAGTCTTCAGTTTGTGAGCCCGTATGCATTCGAGGCCATGCAGAAGGTGGATGTAGCCCGACTGGCAGCTTTAAGTGACCCAGAGCTGCGTCTCCTTCTGCCCTGTCTGGTCAGGATGGCTCTCTGTGCCCCTGCAGATCAGAGCAATGCCTGGGCACAGGATAAGAAGCTCATCCTGCGGCTGCTGTCAGGGGTGGAGGCGGTGAACTCCATTGTTGCTCTGCTGTCTGTGGATTTCCATGCTTTGGAGCAGGATGCTAGAAAAGAGCAGCAGCTAAGGCATAAGGCTGGAGGATCTAATGGCGAGAGCATTCTGGTGTCTCAGCTTCAGCATGGTTTGACTCTGGAGTTTGAGCACAGTGATCCTCTCAGGAGACTCAGACTGGCTCTCAGTGAGCTGCTGGCCATTATGAACAAGGTTCAGTGTCCTTTTATTTATTCCTGCATAGGGATGCTCATTAGGGTAATTTTCCCAACCGGCGCTCATTAATCG

Function

GO:

id name namespace
GO:0034472 snRNA 3'-end processing biological_process
GO:0016180 snRNA processing biological_process
GO:0032039 integrator complex cellular_component
GO:0003674 molecular_function molecular_function

KEGG:

id description
ko03041 Spliceosome

ZFIN:

id description
ZDB-GENE-050522-148 Predicted to be involved in snRNA 3'-end processing. Predicted to act upstream of or within snRNA processing. Predicted to be located in nucleus. Predicted to be part of integrator complex. Orthologous to human INTS2 (integrator complex subunit 2).

Ensembl:

ensembl_id ENSDART00000185445

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00006063 lncRNA downstream 864682 27157937 ~ 27162145 (-) False XLOC_002816
TCONS_00006062 lncRNA downstream 864682 27157937 ~ 27162145 (-) True XLOC_002816
TCONS_00006061 lncRNA downstream 1024213 27000562 ~ 27002614 (-) False XLOC_002813
TCONS_00006060 lncRNA downstream 1024213 27000562 ~ 27002614 (-) True XLOC_002813
TCONS_00005211 lncRNA downstream 1024423 27000562 ~ 27002404 (-) False XLOC_002813
TCONS_00006064 lncRNA upstream 170426 28197916 ~ 28202821 (-) False XLOC_002823
TCONS_00006065 lncRNA upstream 170426 28197916 ~ 28267126 (-) False XLOC_002823
TCONS_00006067 lncRNA upstream 170426 28197916 ~ 28291300 (-) False XLOC_002823
TCONS_00006066 lncRNA upstream 170426 28197916 ~ 28291300 (-) False XLOC_002823
TCONS_00006068 lncRNA upstream 170426 28197916 ~ 28291679 (-) False XLOC_002823
TCONS_00005229 mRNA downstream 285018 27738239 ~ 27741809 (-) True XLOC_002818
TCONS_00005222 mRNA downstream 285034 27183757 ~ 27741793 (-) False XLOC_002818
TCONS_00005234 mRNA upstream 2088 28029578 ~ 28118035 (-) False XLOC_002821
TCONS_00005233 mRNA upstream 2088 28029578 ~ 28118035 (-) False XLOC_002821
TCONS_00005235 mRNA upstream 2552 28030042 ~ 28117740 (-) True XLOC_002821
TCONS_00005236 mRNA upstream 144854 28172344 ~ 28193642 (-) True XLOC_002822
TCONS_00005239 mRNA upstream 283541 28311031 ~ 28368913 (-) False XLOC_002826
TCONS_00005228 other downstream 612465 27414246 ~ 27414362 (-) True XLOC_002819
TCONS_00005218 other downstream 856755 27169956 ~ 27170072 (-) True XLOC_002817
TCONS_00005214 other downstream 1017703 27006271 ~ 27009124 (-) False XLOC_002814
TCONS_00005203 other downstream 1282696 26743596 ~ 26744131 (-) True XLOC_002804
TCONS_00005187 other downstream 1824304 26196284 ~ 26202523 (-) False XLOC_002800
TCONS_00005237 other upstream 171404 28198894 ~ 28199041 (-) False XLOC_002823
TCONS_00005238 other upstream 265353 28292843 ~ 28292959 (-) True XLOC_002825
TCONS_00005248 other upstream 343719 28371209 ~ 28372485 (-) True XLOC_002827
TCONS_00005250 other upstream 415250 28442740 ~ 28443740 (-) True XLOC_002831
TCONS_00005251 other upstream 420416 28447906 ~ 28448868 (-) True XLOC_002832

Expression Profile

//