RNA id: TCONS_00055431


Basic Information

Item Value
RNA id TCONS_00055431
length 479
RNA type mRNA
GC content 0.52
exon number 4
gene id XLOC_028573
representative True

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 11573568 ~ 11603149 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCATTGAATAGCTAGCTTCCCCTTTCTATTCATCCCCCCTAAAATAACCCGTTTTTAACTGTATTACGTATTATACAAACAGTTTACAGTAACGCAATCCAAGTCCACGTCTTTCAAATGGAAGAAACCGACGGATCTCCAGCGCCAATGGCAGAGCCAGTCAACGAAAGACCGAAGAGGAGCAAGAGAAAGTCGTCAATGGTGGAGGCGGACGGGTCCCCAGAGCGCACTTTCAAACGGCCATCTTTGAGACGAGGAAGCTCTTTTACCTTTCTGACACCTGGACCTCAGTGGGACTTCACACTGAAACGCAAGCGCAGGGAAAAGGATGATGCCGATGCAGTCAGTTTGTGCAGCTTTGACTTCAAGGAACCCTGTACTAAGCGTGTGCGGCCTCTTGGCCGAGTGACCTCGCTGGCGAACCTCATCTCTCCCGTGAAGAATGGGGCCGTCCGACGCTTCGGCCAGACCCTCCAGGC

Function

GO:

id name namespace
GO:0060070 canonical Wnt signaling pathway biological_process
GO:0035556 intracellular signal transduction biological_process
GO:0035025 positive regulation of Rho protein signal transduction biological_process
GO:0009950 dorsal/ventral axis specification biological_process
GO:1900107 regulation of nodal signaling pathway biological_process
GO:0048382 mesendoderm development biological_process
GO:0005085 guanyl-nucleotide exchange factor activity molecular_function
GO:0005515 protein binding molecular_function
GO:0030295 protein kinase activator activity molecular_function

KEGG:

id description
ko04111 Cell cycle - yeast

ZFIN:

id description
ZDB-GENE-041121-18 Enables transcription coactivator activity. Acts upstream of or within dorsal/ventral axis specification; mesendoderm development; and regulation of nodal signaling pathway. Located in nucleus. Is expressed in axial mesoderm; margin; and shield. Orthologous to human NET1 (neuroepithelial cell transforming 1).

Ensembl:

ensembl_id ENSDART00000150468

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00055426 lncRNA downstream 173732 11402691 ~ 11404177 (-) True XLOC_028572
TCONS_00055422 lncRNA downstream 329624 11245332 ~ 11248285 (-) True XLOC_028571
TCONS_00055421 lncRNA downstream 390973 11179509 ~ 11186936 (-) True XLOC_028570
TCONS_00055416 lncRNA downstream 452259 11124613 ~ 11125650 (-) False XLOC_028568
TCONS_00055415 lncRNA downstream 452743 11124613 ~ 11125166 (-) False XLOC_028568
TCONS_00055434 lncRNA upstream 7569 11610718 ~ 11637236 (-) False XLOC_028576
TCONS_00055435 lncRNA upstream 7569 11610718 ~ 11637392 (-) False XLOC_028576
TCONS_00058101 lncRNA upstream 7569 11610718 ~ 11690612 (-) False XLOC_028576
TCONS_00058102 lncRNA upstream 7569 11610718 ~ 11691616 (-) False XLOC_028576
TCONS_00058103 lncRNA upstream 7569 11610718 ~ 11692199 (-) True XLOC_028576
TCONS_00055429 mRNA downstream 656 11574907 ~ 11577253 (-) False XLOC_028573
TCONS_00055424 mRNA downstream 172942 11401121 ~ 11404967 (-) False XLOC_028572
TCONS_00055423 mRNA downstream 174050 11401018 ~ 11403859 (-) False XLOC_028572
TCONS_00055425 mRNA downstream 174098 11401124 ~ 11403811 (-) False XLOC_028572
TCONS_00055418 mRNA downstream 411948 11144600 ~ 11165961 (-) False XLOC_028569
TCONS_00055436 mRNA upstream 129007 11732156 ~ 11751037 (-) False XLOC_028577
TCONS_00055437 mRNA upstream 131213 11734362 ~ 11737939 (-) True XLOC_028577
TCONS_00055442 mRNA upstream 201526 11804675 ~ 11810799 (-) False XLOC_028581
TCONS_00055443 mRNA upstream 205988 11809137 ~ 11810365 (-) True XLOC_028581
TCONS_00055444 mRNA upstream 210629 11813778 ~ 12007404 (-) True XLOC_028582
TCONS_00055389 other downstream 916232 10661561 ~ 10661677 (-) True XLOC_028553
TCONS_00055328 other downstream 2990001 8587787 ~ 8587908 (-) True XLOC_028518
TCONS_00055327 other downstream 3436443 8141349 ~ 8141466 (-) True XLOC_028515
TCONS_00055313 other downstream 3701979 7870895 ~ 7875930 (-) False XLOC_028507
TCONS_00055311 other downstream 3702149 7870736 ~ 7875760 (-) False XLOC_028507
TCONS_00055432 other upstream 3609 11606758 ~ 11606855 (-) True XLOC_028574
TCONS_00055433 other upstream 5047 11608196 ~ 11608283 (-) True XLOC_028575
TCONS_00055457 other upstream 671965 12275114 ~ 12286066 (-) True XLOC_028592
TCONS_00055464 other upstream 810270 12413419 ~ 12433016 (-) True XLOC_028596
TCONS_00055465 other upstream 992531 12595680 ~ 12595804 (-) True XLOC_028597

Expression Profile

//