RNA id: TCONS_00055516


Basic Information

Item Value
RNA id TCONS_00055516
length 548
RNA type mRNA
GC content 0.52
exon number 5
gene id XLOC_028623
representative True

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 13605600 ~ 13614936 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCTGCTGGAGAGGCGCGATCAGTCAGTGCGAGCTTGATCTGCACTAAGGACGTTCAGACGCGGATCGAACCTTCACCTGGATATATGCGTCCGTCAGTTGACCTAAAGAACAGTGTTCACCATCACTACCTCCTCCGACCTCTTTGCTGTCCAGCACCATGAGTGGTCAACCACGGAGGATCCGTCTGAAGCCATGGCTGCTGGCACAGATCAACAGCGGGAAATACCCAGGACTGCATTGGCTCAATCAAGAGCGTAGACTCTTTCGGATCCCTTGGAGACATGCCACCCGTCATATGCCTACCCTGGAGGAGGAGAACACTATTTTTAAGGCTTGGGCTCTGGAAACCGGCAAGTACCAGGAAGGAATAGATGAGCCTGATCCAGCCAAATGGAAAGCTAACCTCCGCTGTGCCCTAAACAAAAGTCGGGAGTTCAGACTCAACTACGATGGCACTAAGGACACCCCCGTGCAGCCTTATAAGATCTATGAGGTGTGCGATCAGTCAGTCAATGGAGATGCCGTAGAGGATGAGGAAGAAGAGGTA

Function

GO:

id name namespace
GO:0019221 cytokine-mediated signaling pathway biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0002376 immune system process biological_process
GO:0051607 defense response to virus biological_process
GO:0005634 nucleus cellular_component
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function

KEGG:

id description
ko04620 Toll-like receptor signaling pathway
ko03000 Transcription factors

ZFIN:

id description
ZDB-GENE-040426-2587 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in immune system process and regulation of transcription by RNA polymerase II. Predicted to act upstream of or within cytokine-mediated signaling pathway; defense response to virus; and regulation of transcription, DNA-templated. Predicted to be active in nucleus. Is expressed in several structures, including gill; heart; immune system; liver; and muscle. Human ortholog(s) of this gene implicated in herpes simplex; inflammatory bowel disease 14; multiple sclerosis; rheumatoid arthritis; and systemic lupus erythematosus. Orthologous to human IRF5 (interferon regulatory factor 5).

Ensembl:

ensembl_id ENSDART00000138366

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00057336 lncRNA downstream 119339 13489763 ~ 13490081 (-) True XLOC_028615
TCONS_00058127 lncRNA downstream 130599 13477229 ~ 13478821 (-) True XLOC_028614
TCONS_00057335 lncRNA downstream 216250 13345672 ~ 13393170 (-) False XLOC_028613
TCONS_00057334 lncRNA downstream 216250 13345672 ~ 13393170 (-) True XLOC_028613
TCONS_00055501 lncRNA downstream 452677 13138005 ~ 13156743 (-) False XLOC_028612
TCONS_00055517 lncRNA upstream 11185 13625982 ~ 13626833 (-) True XLOC_028624
TCONS_00058128 lncRNA upstream 265739 13880536 ~ 13889277 (-) False XLOC_028626
TCONS_00058129 lncRNA upstream 265739 13880536 ~ 13889482 (-) True XLOC_028626
TCONS_00055522 lncRNA upstream 294511 13909308 ~ 13921170 (-) True XLOC_028628
TCONS_00058130 lncRNA upstream 354364 13969161 ~ 13979713 (-) True XLOC_028631
TCONS_00055511 mRNA downstream 29072 13577665 ~ 13580348 (-) True XLOC_028622
TCONS_00055508 mRNA downstream 41904 13551400 ~ 13567516 (-) False XLOC_028621
TCONS_00055509 mRNA downstream 42033 13551460 ~ 13567387 (-) False XLOC_028621
TCONS_00055507 mRNA downstream 60614 13544595 ~ 13548806 (-) True XLOC_028620
TCONS_00055506 mRNA downstream 70706 13535054 ~ 13538714 (-) True XLOC_028619
TCONS_00055518 mRNA upstream 84188 13698985 ~ 13723156 (-) True XLOC_028625
TCONS_00055519 mRNA upstream 277976 13892773 ~ 13902188 (-) True XLOC_028627
TCONS_00055520 mRNA upstream 290725 13905522 ~ 13921206 (-) False XLOC_028628
TCONS_00055521 mRNA upstream 291744 13906541 ~ 13921185 (-) False XLOC_028628
TCONS_00055523 mRNA upstream 309130 13923927 ~ 13931293 (-) False XLOC_028629
TCONS_00055510 other downstream 42145 13563667 ~ 13567275 (-) True XLOC_028621
TCONS_00055502 other downstream 353607 13208111 ~ 13255813 (-) True XLOC_028612
TCONS_00055495 other downstream 630521 12975216 ~ 12978899 (-) True XLOC_028608
TCONS_00055491 other downstream 695250 12906981 ~ 12914170 (-) True XLOC_028606
TCONS_00055473 other downstream 828285 12777709 ~ 12781135 (-) True XLOC_028602
TCONS_00055533 other upstream 552245 14167042 ~ 14169631 (-) False XLOC_028633
TCONS_00055536 other upstream 561724 14176521 ~ 14179480 (-) True XLOC_028636
TCONS_00055542 other upstream 573730 14188527 ~ 14189659 (-) False XLOC_028638
TCONS_00055543 other upstream 576255 14191052 ~ 14191984 (-) True XLOC_028638
TCONS_00055545 other upstream 583227 14198024 ~ 14205228 (-) True XLOC_028639

Expression Profile

//