RNA id: TU2416322



Basic Information


Item Value
RNA id TU2416322
length 212
lncRNA type inter_gene
GC content 0.45
exon number 1
gene id G2112974
representative True

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 18557598 ~ 18557809 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gttctatcttgatggaaaatgttgtagttgggtatggaaatctcagaattgttggtggccttcctaagccaggattcagacacgtcaaggacatcagggttggcggagtgtgctaaagcggtgagtaaaacaaacttagggaggaggcttttgatgttgacatgcatgaaaccaaggctttttcgatcagagatgtcaacaaatgagggtgc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU2416312 lncRNA upstream 5359 18551941 ~ 18552239 (+) True G2112964
TU2416308 lncRNA upstream 10847 18546522 ~ 18546751 (+) True G2112960
TU2416306 lncRNA upstream 11782 18545570 ~ 18545816 (+) True G2112958
TU2416090 lncRNA upstream 122519 18428830 ~ 18435079 (+) True G2112765
TU2416087 lncRNA upstream 161043 18396138 ~ 18396555 (+) True G2112763
TU2416324 lncRNA downstream 813 18558622 ~ 18558842 (+) True G2112976
TU2416327 lncRNA downstream 3498 18561307 ~ 18561590 (+) True G2112979
TU2416344 lncRNA downstream 13097 18570906 ~ 18571180 (+) True G2112996
TU2416391 lncRNA downstream 44978 18602787 ~ 18627157 (+) True G2113037
TU2416435 lncRNA downstream 145875 18703684 ~ 18703950 (+) True G2113081
XM_021589358.2 mRNA upstream 137591 18406183 ~ 18420007 (+) True LOC100136150
XM_021589356.2 mRNA upstream 186714 18366089 ~ 18370884 (+) True LOC110508663
XM_036966799.1 mRNA upstream 203226 18317480 ~ 18354372 (+) False LOC110508661
XM_036967035.1 mRNA downstream 21654 18579463 ~ 18658560 (+) False LOC110508667
XM_021589369.2 mRNA downstream 21655 18579464 ~ 18658560 (+) False LOC110508667
XM_021589370.2 mRNA downstream 21656 18579465 ~ 18658560 (+) False LOC110508667
XM_036967036.1 mRNA downstream 21657 18579466 ~ 18658560 (+) True LOC110508667
XM_021589376.2 mRNA downstream 115493 18673302 ~ 18724171 (+) False LOC110508668
TU2415395 other upstream 653674 17903198 ~ 17903924 (+) True G2112127
TU2414674 other upstream 802017 17754937 ~ 17755581 (+) True G2111491
TU2414638 other upstream 848969 17708256 ~ 17708629 (+) True G2111457
TU2414472 other upstream 1141366 17411144 ~ 17416232 (+) True G2111300
TU2414198 other upstream 1598746 16953784 ~ 16958852 (+) True G2111044
TU2416413 other downstream 109306 18667115 ~ 18668496 (+) True G2113059
TU2416973 other downstream 518268 19076077 ~ 19076418 (+) True G2113578
TU2417581 other downstream 1065659 19623468 ~ 19636753 (+) True LOC110508695
TU2418949 other downstream 1883924 20441733 ~ 20442169 (+) True G2115369
TU2419398 other downstream 2282761 20840570 ~ 20842003 (+) True LOC110508722

Expression Profile


TU2416322 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU2416322 Expression in each Bioproject

Bar chart with 16 bars.
TU2416322 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.