RNA id: TU2416973



Basic Information


Item Value
RNA id TU2416973
length 342
RNA type TUCP
GC content 0.51
exon number 1
gene id G2113578
representative True

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 19076077 ~ 19076418 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tccccctgctcaagccagcgcatgtccaggcccgtctgaagtttgccaatgaccatctggatgatccagaggaggaatgggagaaggtcatgtggtctgatgagacaaaaatagagctttttggtctaaactccactcgccgtgtttggaggaagaagaaggatgagtacaaccccaagaacaccatcccaaccatgaagcatggaggtggaaacatcattctttggggatgcttttctgcaaaggggacaggacgactgcaccgtattgaggggaggatggatggggccatgtatcgcgagatcttggccaacaacctccttccctcagtaagagcattga

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU2416971 lncRNA upstream 2413 19073445 ~ 19073664 (+) True G2113576
TU2416970 lncRNA upstream 3342 19072496 ~ 19072735 (+) True G2113575
TU2416966 lncRNA upstream 6266 19067782 ~ 19069811 (+) True G2113571
TU2416948 lncRNA upstream 22477 19053233 ~ 19053600 (+) True G2113553
TU2416947 lncRNA upstream 23187 19052477 ~ 19052890 (+) True G2113552
TU2416975 lncRNA downstream 1680 19078098 ~ 19078350 (+) True G2113580
TU2416988 lncRNA downstream 24812 19101230 ~ 19101450 (+) True G2113593
TU2417049 lncRNA downstream 115519 19191937 ~ 19192290 (+) True G2113646
TU2417052 lncRNA downstream 117409 19193827 ~ 19197541 (+) True G2113648
TU2417065 lncRNA downstream 128670 19205088 ~ 19205323 (+) True G2113656
XM_021589383.2 mRNA upstream 64436 18986697 ~ 19011641 (+) False LOC110508675
XM_021589384.2 mRNA upstream 64436 18986697 ~ 19011641 (+) False LOC110508675
XR_002471341.2 mRNA upstream 210663 18849186 ~ 18865414 (+) True LOC110508672
XM_021589377.2 mRNA upstream 259491 18726254 ~ 18816586 (+) False LOC110508669
XM_021589376.2 mRNA upstream 351906 18673302 ~ 18724171 (+) False LOC110508668
XR_005040194.1 mRNA downstream 128954 19205372 ~ 19209070 (+) False LOC110508679
XR_005040193.1 mRNA downstream 128956 19205374 ~ 19209070 (+) False LOC110508679
XR_005040192.1 mRNA downstream 128962 19205380 ~ 19209070 (+) False LOC110508679
XM_021589392.2 mRNA downstream 128972 19205390 ~ 19208117 (+) False LOC110508679
XM_021589393.2 mRNA downstream 128972 19205390 ~ 19208117 (+) False LOC110508679
TU2416413 other upstream 407581 18667115 ~ 18668496 (+) True G2113059
TU2415395 other upstream 1172153 17903198 ~ 17903924 (+) True G2112127
TU2414674 other upstream 1320496 17754937 ~ 17755581 (+) True G2111491
TU2414638 other upstream 1367448 17708256 ~ 17708629 (+) True G2111457
TU2414472 other upstream 1659845 17411144 ~ 17416232 (+) True G2111300
TU2417581 other downstream 547050 19623468 ~ 19636753 (+) True LOC110508695
TU2418949 other downstream 1365315 20441733 ~ 20442169 (+) True G2115369
TU2419398 other downstream 1764152 20840570 ~ 20842003 (+) True LOC110508722
TU2420043 other downstream 2298077 21374495 ~ 21375078 (+) True G2116347
TU2422383 other downstream 4003998 23080416 ~ 23087819 (+) True smg7

Expression Profile


TU2416973 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

TU2416973 Expression in each Bioproject

Bar chart with 21 bars.
TU2416973 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.