RNA id: TCONS_00055669


Basic Information

Item Value
RNA id TCONS_00055669
length 594
RNA type mRNA
GC content 0.55
exon number 2
gene id XLOC_028713
representative True

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 18432182 ~ 18436899 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGACCTGTCACTCATCCGACTCCACGGAAAGCATCGAGAATGAAAGGAGATCGCAATCCGAAACCCAAGTCGCCGACACCGAGCAGAGTCGCATTGCCACTGCCATGAGAGACCTTAAAAACACTGGCTGGTATTGGGGCAGCCTGACAGCCAATGAAGCCAAGGAGATCCTGCAGGACACGTCGGAGGGGACGTTTCTCGTCCGGGACAGCTCTCAGAGGGACTACCTCTTCACCATCTCCGCCATGACATCTGCGGGACCGACCAACCTGCGGATCGAATACAAGGACGGCAAGTTCAAGCTGGACTCTGTGGTGCTGGTCAAACCCAAACTCAAGCAGTTCGACAGCGTGGTGCATCTCGTGGAGCATTACGTGCAGCTGTCCCGGACGTCTTGTAAAGGCAGGACTAACCAAATCGCCCCGTCCAATGGTACCGTGCAGCTGCTTCTCACGACTCCGGTGTACACGGCCACGCCGTCCCTGCAGCACCTGTGCCGTATTGCCATCAATAAAACCACACGACGGGTACAAGAACTTCCTTTGCCCAACCGGCTGAAGGATTACCTGACAGACTACACTTATAATGTATAG

Function

GO:

id name namespace
GO:0046854 phosphatidylinositol phosphorylation biological_process
GO:0035556 intracellular signal transduction biological_process
GO:0001558 regulation of cell growth biological_process
GO:0016567 protein ubiquitination biological_process
GO:0046426 negative regulation of receptor signaling pathway via JAK-STAT biological_process
GO:0005942 phosphatidylinositol 3-kinase complex cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005159 insulin-like growth factor receptor binding molecular_function
GO:0046935 1-phosphatidylinositol-3-kinase regulator activity molecular_function
GO:0008269 JAK pathway signal transduction adaptor activity molecular_function

KEGG:

id description
ko04630 JAK-STAT signaling pathway
ko04910 Insulin signaling pathway
ko04917 Prolactin signaling pathway
ko04935 Growth hormone synthesis, secretion and action
ko04930 Type II diabetes mellitus
ko04121 Ubiquitin system

ZFIN:

id description
ZDB-GENE-041210-171 Predicted to enable 1-phosphatidylinositol-3-kinase regulator activity. Predicted to be involved in phosphatidylinositol phosphate biosynthetic process. Predicted to act upstream of or within intracellular signal transduction; negative regulation of receptor signaling pathway via JAK-STAT; and regulation of cell growth. Predicted to be located in cytoplasm. Predicted to be part of phosphatidylinositol 3-kinase complex. Human ortholog(s) of this gene implicated in endometrial cancer and ovarian carcinoma. Orthologous to human SOCS2 (suppressor of cytokine signaling 2).

Ensembl:

ensembl_id ENSDART00000190271

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00058187 lncRNA downstream 549923 17875071 ~ 17882930 (-) True XLOC_028707
TCONS_00058186 lncRNA downstream 549976 17875071 ~ 17882877 (-) False XLOC_028707
TCONS_00058185 lncRNA downstream 550234 17875071 ~ 17882619 (-) False XLOC_028707
TCONS_00058184 lncRNA downstream 550356 17875071 ~ 17882497 (-) False XLOC_028707
TCONS_00058183 lncRNA downstream 858171 17571295 ~ 17574682 (-) False XLOC_028696
TCONS_00055681 lncRNA upstream 171011 18605935 ~ 18606567 (-) True XLOC_028717
TCONS_00057349 lncRNA upstream 219758 18654682 ~ 18679692 (-) True XLOC_028721
TCONS_00058188 lncRNA upstream 277839 18712763 ~ 18714926 (-) True XLOC_028722
TCONS_00058189 lncRNA upstream 517558 18952482 ~ 18954075 (-) False XLOC_028727
TCONS_00058190 lncRNA upstream 517558 18952482 ~ 18964897 (-) False XLOC_028727
TCONS_00055667 mRNA downstream 16287 18383253 ~ 18416566 (-) True XLOC_028712
TCONS_00055665 mRNA downstream 116941 18283122 ~ 18315912 (-) False XLOC_028711
TCONS_00055666 mRNA downstream 122936 18289119 ~ 18309917 (-) True XLOC_028711
TCONS_00055664 mRNA downstream 127921 18281954 ~ 18304932 (-) False XLOC_028711
TCONS_00055663 mRNA downstream 151783 18209038 ~ 18281070 (-) True XLOC_028710
TCONS_00055670 mRNA upstream 18778 18453702 ~ 18455480 (-) False XLOC_028714
TCONS_00055671 mRNA upstream 18825 18453749 ~ 18454591 (-) True XLOC_028714
TCONS_00055672 mRNA upstream 65088 18500012 ~ 18512550 (-) True XLOC_028715
TCONS_00055673 mRNA upstream 157819 18592743 ~ 18595525 (-) False XLOC_028716
TCONS_00055675 mRNA upstream 162238 18597162 ~ 18606524 (-) False XLOC_028717
TCONS_00055660 other downstream 243333 18189406 ~ 18189520 (-) True XLOC_028709
TCONS_00055659 other downstream 343847 18035497 ~ 18089006 (-) True XLOC_028708
TCONS_00055658 other downstream 394306 17999517 ~ 18038547 (-) False XLOC_028708
TCONS_00055657 other downstream 483535 17915932 ~ 17949318 (-) False XLOC_028708
TCONS_00055647 other downstream 695041 17736443 ~ 17737812 (-) True XLOC_028702
TCONS_00055674 other upstream 158906 18593830 ~ 18595140 (-) True XLOC_028716
TCONS_00055676 other upstream 162736 18597660 ~ 18606538 (-) False XLOC_028717
TCONS_00055683 other upstream 218224 18653148 ~ 18653241 (-) True XLOC_028719
TCONS_00055684 other upstream 219231 18654155 ~ 18654261 (-) True XLOC_028720
TCONS_00055699 other upstream 612542 19047466 ~ 19047555 (-) True XLOC_028730

Expression Profile

//