RNA id: TU2438858



Basic Information


Item Value
RNA id TU2438858
length 467
lncRNA type antisense_over
GC content 0.44
exon number 2
gene id G2132917
representative True

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 36036659 ~ 36037337 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CACACTATCCTGATTGGACCTCTCCTCTGCCGTCCTCTCGGAAGCAATGTCCATCGCCTTTTCCAAGTAGAGGTTGATGTTGCTGCTGGTGATGGAGGGATCGGTGACGAACTCAAAGAGCTCGCGCAAAGTCATCGCCGCTACCCCTCTCTTCAGGAAAAAGTCTGAGGGACACGGGACCAAATCTCATCGAGCCTTTTATCCAAACTCAGAGCCTCATACTTCCAACAGAAACCATAGGCACGGGACACTCCTAGTATATGCACTGCCTCTTGTCCTATAACCTCTCGTCTACATTAACCTCTGTGTTTCACATATTACGTGCATGTCGGGTTGGAGTTACGGCAATCTCAGATGAAATGTAGCTACATTTGACGATATTAAACAAAACAGAACTTTCATTCATGTTTTGTTTCGAAAAACCTTTTAGAATATTAGAACGCTTTGTCAAATAATAAAAGAAACCA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU2438842 lncRNA downstream 10656 36020138 ~ 36026003 (-) True G2132911
TU2438846 lncRNA downstream 11558 36023780 ~ 36025101 (-) False LOC118944844
TU2438845 lncRNA downstream 11558 36023790 ~ 36025101 (-) False LOC118944844
TU2438841 lncRNA downstream 17202 36018933 ~ 36019457 (-) True G2132910
TU2438834 lncRNA downstream 34986 36001304 ~ 36001673 (-) True G2132903
TU2438864 lncRNA upstream 4197 36041534 ~ 36041826 (-) True G2132923
TU2438875 lncRNA upstream 40139 36077476 ~ 36077703 (-) True G2132934
TU2438969 lncRNA upstream 119891 36157228 ~ 36158288 (-) False G2132992
TU2438971 lncRNA upstream 119891 36157228 ~ 36157789 (-) True G2132992
TU2438946 lncRNA upstream 159512 36196849 ~ 36197432 (-) True G2132969
XM_036966480.1 mRNA downstream 10924 36023714 ~ 36025735 (-) False LOC118944844
XM_036966844.1 mRNA downstream 18786 36016086 ~ 36017873 (-) False lyrm4
XM_021590059.2 mRNA downstream 23612 36002853 ~ 36013047 (-) False rpp40
XM_021590060.2 mRNA downstream 23612 36002853 ~ 36013047 (-) True rpp40
XM_036966073.1 mRNA downstream 110876 35870156 ~ 35925783 (-) False LOC110509091
XM_021590063.2 mRNA upstream 6704 36044041 ~ 36052174 (-) False LOC110509099
XR_005040236.1 mRNA upstream 6704 36044041 ~ 36052175 (-) False LOC110509099
XM_036966658.1 mRNA upstream 6704 36044041 ~ 36052176 (-) True LOC110509099
XM_021590064.2 mRNA upstream 16081 36053418 ~ 36064572 (-) True LOC110509100
XM_036966173.1 mRNA upstream 155432 36192769 ~ 36218674 (-) False fastk
TU2438849 other downstream 11458 36023780 ~ 36025201 (-) False LOC118944844
TU2438850 other downstream 11458 36023790 ~ 36025201 (-) True LOC118944844
TU2438804 other downstream 18827 36005489 ~ 36017832 (-) False lyrm4
TU2438803 other downstream 18827 36016062 ~ 36017832 (-) True lyrm4
TU2437347 other downstream 1518530 34516522 ~ 34518129 (-) False G2131641
TU2438948 other upstream 186876 36224213 ~ 36225379 (-) True G2132971
TU2438933 other upstream 198178 36235515 ~ 36249775 (-) False G2132966
TU2438943 other upstream 200893 36238230 ~ 36249775 (-) True G2132966
TU2438987 other upstream 225665 36263002 ~ 36263330 (-) True G2133007
TU2439020 other upstream 519163 36556500 ~ 36557453 (-) True LOC110509111

Expression Profile


TU2438858 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU2438858 Expression in each Bioproject

Bar chart with 14 bars.
TU2438858 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.