RNA id: TU2445727



Basic Information


Item Value
RNA id TU2445727
length 310
lncRNA type inter_gene
GC content 0.49
exon number 3
gene id G2138414
representative True

Chromosome Information


Item Value
chromosome id NC_048592.1
NCBI id CM023246.2
chromosome length 43716683
location 42599681 ~ 42600138 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ACACGCCTGTTATAGTGTGGACTGGTTAATCTGGGGTCTAACACACGCCTGTTATAGTGTGGACTGGTTAGTCTGGGGTCTAACACACGCCTGTTATAGTGTAGACTGGTTACTCTGGGGTCTAACACACGCCTGTTATAGTGTGGACTGGTTAGTCTGGTTTCAGAGAGGTCAGCCTATTATAGGCAGACCCCAGAGTAACCAGTCCACACTATAACAGGCGCGTGTTAGACCCCAGACTAACCAGTCTACACTATAACAGGCGTGTGTTAGACCCCAGACTAACCATGGTTACCATGGAGACAAGGAC

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU2445686 lncRNA downstream 76897 42522314 ~ 42522784 (-) True G2138386
TU2445663 lncRNA downstream 122038 42476443 ~ 42477643 (-) True G2138367
TU2445662 lncRNA downstream 123822 42475470 ~ 42475859 (-) True G2138366
TU2445653 lncRNA downstream 138153 42460429 ~ 42461528 (-) True G2138358
TU2445642 lncRNA downstream 168037 42431289 ~ 42431644 (-) True G2138348
TU2445734 lncRNA upstream 10919 42611057 ~ 42615032 (-) True G2138420
TU2445761 lncRNA upstream 23152 42623290 ~ 42625470 (-) False G2138424
TU2445756 lncRNA upstream 23202 42623340 ~ 42625470 (-) False G2138424
TU2445754 lncRNA upstream 23416 42623554 ~ 42625470 (-) False G2138424
TU2445757 lncRNA upstream 23416 42623554 ~ 42625470 (-) False G2138424
XM_021590154.2 mRNA downstream 91476 42498739 ~ 42508205 (-) True them6
XM_036965944.1 mRNA downstream 91531 42498739 ~ 42508150 (-) False them6
XM_036965945.1 mRNA downstream 91549 42498283 ~ 42508132 (-) False them6
XM_036965943.1 mRNA downstream 105844 42471891 ~ 42493837 (-) True LOC110509174
XM_036966737.1 mRNA downstream 188980 42400515 ~ 42410701 (-) True LOC110509173
XM_036966602.1 mRNA upstream 30007 42630145 ~ 42691448 (-) False LOC110508271
XM_036966601.1 mRNA upstream 30007 42630145 ~ 42703120 (-) False LOC110508271
XM_036966603.1 mRNA upstream 30007 42630145 ~ 42703120 (-) False LOC110508271
XM_036967019.1 mRNA upstream 133505 42733643 ~ 42772837 (-) False LOC110509177
XM_036967020.1 mRNA upstream 133505 42733643 ~ 42772837 (-) False LOC110509177
TU2445575 other downstream 248229 42349216 ~ 42351452 (-) True G2138294
TU2444991 other downstream 372716 42220922 ~ 42226965 (-) False G2137814
TU2444984 other downstream 373317 42220922 ~ 42226364 (-) False G2137814
TU2444782 other downstream 785480 41810795 ~ 41814201 (-) True G2137648
TU2444670 other downstream 863292 41731714 ~ 41736389 (-) True G2137555
TU2446193 other upstream 774609 43374747 ~ 43375558 (-) True emilin2a

Expression Profile


TU2445727 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU2445727 Expression in each Bioproject

Bar chart with 4 bars.
TU2445727 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.