RNA id: TCONS_00055836


Basic Information

Item Value
RNA id TCONS_00055836
length 399
RNA type mRNA
GC content 0.52
exon number 4
gene id XLOC_028818
representative False

Chromosome Information

Item Value
chromosome id NC_007115.7
NCBI id CM002888.2
chromosome length 78093715
location 27251865 ~ 27398414 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGCTCCGGCGGTCAGATCGATTAAGCGTAAGGATGCGATTAACTGGCCGAGGATGTCGACAACTTTCTGGGCTGTGCTGCTGTTGACGGCGCTTCTGATCGTGTACTGCGGTCAACTTGCAGCAGGCACCTGTGAGATTGTCACTTTAGACAAAGACAGCAGTCAGCCACGCAGGACGATTGCCAGACAGACAGCTCGCTGTGCATGTAAGAAAGGACAGATTGCTGGGACAACGAATGCCAGGCCGGCCTGTGTGGACGCTCGTATCGTGAAGACCAAGCAGTGGTGTGACATGGTGCCCTGTCTAGAGGATGAAGAGTGTGACTTGTTAGTAAATAAATCTGGCTGGACTTGTACACAGCCAAGTGGCAGAGTGAAAACTACAACGGTGTCCTAA

Function

GO:

id name namespace
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-041210-344 Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in brain. Orthologous to human TAFA5 (TAFA chemokine like family member 5).

Ensembl:

ensembl_id ENSDART00000150553

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00058220 lncRNA downstream 413632 26839078 ~ 26839608 (-) True XLOC_028814
TCONS_00058219 lncRNA downstream 487430 26752348 ~ 26765810 (-) True XLOC_028813
TCONS_00057358 lncRNA downstream 831013 26417507 ~ 26422227 (-) True XLOC_028812
TCONS_00057357 lncRNA downstream 1001119 26250874 ~ 26252121 (-) True XLOC_028808
TCONS_00055823 lncRNA downstream 1105690 26127177 ~ 26147550 (-) True XLOC_028807
TCONS_00058221 lncRNA upstream 1226455 28624869 ~ 28627715 (-) False XLOC_028826
TCONS_00057359 lncRNA upstream 1226455 28624869 ~ 28628533 (-) False XLOC_028826
TCONS_00058222 lncRNA upstream 1226455 28624869 ~ 28632583 (-) True XLOC_028826
TCONS_00058223 lncRNA upstream 1320815 28719229 ~ 28720774 (-) False XLOC_028827
TCONS_00058224 lncRNA upstream 1320815 28719229 ~ 28728040 (-) True XLOC_028827
TCONS_00055830 mRNA downstream 123543 27112399 ~ 27129697 (-) False XLOC_028816
TCONS_00055831 mRNA downstream 136128 27113213 ~ 27117112 (-) True XLOC_028816
TCONS_00055828 mRNA downstream 154016 27081972 ~ 27099224 (-) False XLOC_028815
TCONS_00055826 mRNA downstream 839849 26390851 ~ 26413391 (-) True XLOC_028810
TCONS_00055825 mRNA downstream 930404 26314018 ~ 26322836 (-) True XLOC_028809
TCONS_00055838 mRNA upstream 228455 27626869 ~ 27897315 (-) False XLOC_028819
TCONS_00055839 mRNA upstream 229044 27627458 ~ 27897160 (-) False XLOC_028819
TCONS_00055840 mRNA upstream 315028 27713442 ~ 27897271 (-) True XLOC_028819
TCONS_00055841 mRNA upstream 664059 28062473 ~ 28158335 (-) False XLOC_028820
TCONS_00055842 mRNA upstream 665878 28064292 ~ 28161198 (-) True XLOC_028820
TCONS_00055832 other downstream 111937 27141179 ~ 27141303 (-) True XLOC_028817
TCONS_00055829 other downstream 153955 27088371 ~ 27099285 (-) True XLOC_028815
TCONS_00055827 other downstream 845977 26407146 ~ 26407263 (-) True XLOC_028811
TCONS_00055813 other downstream 1412338 25840786 ~ 25840902 (-) True XLOC_028802
TCONS_00055802 other downstream 1774245 25474206 ~ 25478995 (-) False XLOC_028796
TCONS_00055849 other upstream 1033917 28432331 ~ 28432445 (-) True XLOC_028824
TCONS_00055850 other upstream 1143607 28542021 ~ 28542135 (-) True XLOC_028825
TCONS_00055851 other upstream 1431480 28829894 ~ 28855677 (-) False XLOC_028829
TCONS_00055888 other upstream 3556927 30955341 ~ 30955504 (-) True XLOC_028861
TCONS_00055889 other upstream 3576502 30974916 ~ 30975079 (-) True XLOC_028862

Expression Profile

//