RNA id: TCONS_00005284


Basic Information

Item Value
RNA id TCONS_00005284
length 761
RNA type mRNA
GC content 0.42
exon number 5
gene id XLOC_002853
representative False

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 29896275 ~ 29903165 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTTTCTATTCAACCGCTAAACGCTAGTGCTAAGAGCTGCTGGAAAGCTGCCTGTACAGCCATTATTGGGCCCTGGCGTATATTATTTAGACTTCATTTAGAGGTTTGATAAAGTCTGTCTGTAGGTGCAGAATGTACAGCTTCTTGGGAGGAGGGCTGTTTTGTGCAGGAGTGGGCAATATACTCCTGATTGTTTCCACAGCAACAGATTATTGGATGCAGTACCGTCATTCAAACAACTACATGCATCAGGGACTGTGGAGATACTGCACGCCTGGAAAATGCTTCACACACACTGACAGCATTGCATACTGGGATGCTACACGAGCATTCATGATCTTGTCTCTTTTGGCCTGCTTCATTGGCATCATCATCGGTATTATGGCCTTCATCCATTACTCCTCCTTTGACAGGTTTGATAAAACCTTTGCTGCAGGCATTCTGTTCTTCATCTCTTGCTTTTTTGTGTTTCTGGCCATGGCTGTCTACACGGGAGTCACAATAAATTACTATGGTAAACGCTATGGTAATTGGAGGTTCTCCTGGTCTTACATCATTGGCTGGGTGTCTGTTGTGCTCACTTTCTTTTCAGGAATGTTCTACATGTGTGCATACCGGATGCATGAATGCCCCAGAAGCTCAAATCCTCATTAGAAGATGAAGCTTTATTATCTTCAATGATGGAAACCACTTCAGTACCATTAAAAAATAGAACAAAGCAAATTGTCAATAAAGAATAGTAGATAGTATGTGTGAACTCTT

Function

GO:

id name namespace
GO:0005886 plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050522-398 Predicted to be a structural constituent of eye lens. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in plasma membrane. Is expressed in lens and solid lens vesicle. Human ortholog(s) of this gene implicated in cataract and cataract 19 multiple types. Orthologous to human LIM2 (lens intrinsic membrane protein 2).

Ensembl:

ensembl_id ENSDART00000078800

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00006075 lncRNA downstream 405188 29266270 ~ 29491087 (-) True XLOC_002843
TCONS_00005269 lncRNA downstream 758271 29128202 ~ 29138004 (-) True XLOC_002841
TCONS_00006074 lncRNA downstream 1431249 28460213 ~ 28465026 (-) True XLOC_002834
TCONS_00005770 lncRNA downstream 1478096 28417651 ~ 28418179 (-) True XLOC_002830
TCONS_00006073 lncRNA downstream 1510706 28382085 ~ 28385569 (-) True XLOC_002828
TCONS_00005294 lncRNA upstream 1359687 31262852 ~ 31294777 (-) False XLOC_002858
TCONS_00006076 lncRNA upstream 1359687 31262852 ~ 31295006 (-) True XLOC_002858
TCONS_00006077 lncRNA upstream 2174646 32077811 ~ 32084121 (-) False XLOC_002862
TCONS_00006078 lncRNA upstream 2174646 32077811 ~ 32084624 (-) True XLOC_002862
TCONS_00006079 lncRNA upstream 2313248 32216413 ~ 32250771 (-) False XLOC_002863
TCONS_00005283 mRNA downstream 3789 29890535 ~ 29892486 (-) True XLOC_002852
TCONS_00005280 mRNA downstream 64331 29820172 ~ 29831944 (-) False XLOC_002851
TCONS_00005282 mRNA downstream 64331 29829513 ~ 29831944 (-) True XLOC_002851
TCONS_00005281 mRNA downstream 69275 29824230 ~ 29827000 (-) False XLOC_002851
TCONS_00005279 mRNA downstream 79808 29815644 ~ 29816467 (-) True XLOC_002850
TCONS_00005287 mRNA upstream 714661 30617826 ~ 30785501 (-) True XLOC_002855
TCONS_00005288 mRNA upstream 1094073 30997238 ~ 31016806 (-) False XLOC_002856
TCONS_00005289 mRNA upstream 1096586 30999751 ~ 31015535 (-) True XLOC_002856
TCONS_00005290 mRNA upstream 1116442 31019607 ~ 31104983 (-) False XLOC_002857
TCONS_00005291 mRNA upstream 1117394 31020559 ~ 31220558 (-) False XLOC_002857
TCONS_00005276 other downstream 157167 29736186 ~ 29739108 (-) True XLOC_002847
TCONS_00005273 other downstream 188093 29708068 ~ 29708182 (-) True XLOC_002845
TCONS_00005263 other downstream 972642 28923517 ~ 28923633 (-) True XLOC_002838
TCONS_00005262 other downstream 974024 28922135 ~ 28922251 (-) True XLOC_002837
TCONS_00005252 other downstream 1441104 28454500 ~ 28455171 (-) True XLOC_002833
TCONS_00005286 other upstream 627978 30531143 ~ 30531257 (-) True XLOC_002854
TCONS_00005293 other upstream 1118191 31021356 ~ 31104754 (-) True XLOC_002857
TCONS_00005308 other upstream 2639371 32542536 ~ 32610769 (-) False XLOC_002866
TCONS_00005309 other upstream 2664459 32567624 ~ 32610694 (-) True XLOC_002866
TCONS_00005329 other upstream 3473653 33376818 ~ 33376941 (-) True XLOC_002883

Expression Profile

//