RNA id: TU2471631



Basic Information


Item Value
RNA id TU2471631
length 286
lncRNA type inter_gene
GC content 0.35
exon number 1
gene id G2162004
representative True

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 19984224 ~ 19984509 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ggtcatacaggcacgtggaggccacacacactactgagcctcattttgacttgttttaaggacattacatcaaagttggatcagcctgtagtgtggttttccactttaattttgagtgtgactccaaatccagacctccatgggttgataaatttgatttccattgatcatttttatgtgattttgttgtcagcacattcaactatgtaaagaaaaaagtatttaataagaatatttcattcattcagatctaggatgtgttattttagtgttccctttatttttt

Function


GO: NA

KEGG:

id description

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU2471619 lncRNA downstream 10069 19973873 ~ 19974155 (-) True G2161992
TU2471598 lncRNA downstream 28007 19955907 ~ 19956217 (-) True G2161978
TU2471595 lncRNA downstream 31600 19952311 ~ 19952624 (-) True G2161975
TU2471589 lncRNA downstream 39144 19944805 ~ 19945080 (-) True G2161972
TU2471587 lncRNA downstream 42281 19941606 ~ 19941943 (-) True G2161970
TU2471641 lncRNA upstream 4970 19989479 ~ 19989868 (-) True G2162013
TU2471642 lncRNA upstream 5390 19989899 ~ 19990316 (-) True G2162014
TU2471722 lncRNA upstream 7948 19992457 ~ 19992675 (-) True G2162074
TU2471725 lncRNA upstream 9499 19994008 ~ 19994251 (-) True G2162077
TU2471739 lncRNA upstream 23965 20008474 ~ 20011382 (-) True G2162087
XM_036968089.1 mRNA downstream 33600 19946567 ~ 19950624 (-) True LOC110509780
XM_036968090.1 mRNA downstream 33601 19946567 ~ 19950623 (-) False LOC110509780
XM_021590205.2 mRNA downstream 78351 19882762 ~ 19905873 (-) True traf2
NM_001124393.2 mRNA downstream 80782 19882762 ~ 19903442 (-) False traf2
XR_005040396.1 mRNA downstream 143545 19838055 ~ 19840679 (-) True LOC110509775
XM_021590891.2 mRNA upstream 38619 20023128 ~ 20025908 (-) True LOC110509785
XM_036967984.1 mRNA upstream 66286 20050795 ~ 20063779 (-) False LOC110509787
XM_036967979.1 mRNA upstream 66286 20050795 ~ 20063782 (-) False LOC110509787
XM_036967980.1 mRNA upstream 66286 20050795 ~ 20063782 (-) False LOC110509787
XM_036967982.1 mRNA upstream 66286 20050795 ~ 20063782 (-) False LOC110509787
TU2470823 other downstream 707218 19276268 ~ 19277006 (-) True LOC110509757
TU2467320 other downstream 3337627 16643681 ~ 16646597 (-) True G2158111
TU2467297 other downstream 3376218 16607625 ~ 16608006 (-) True G2158088
TU2466925 other downstream 3560803 16421677 ~ 16423421 (-) True G2157743
TU2466897 other downstream 3598179 16381190 ~ 16386045 (-) True G2157715
TU2471632 other upstream 36 19984545 ~ 19984779 (-) True G2162005
TU2471779 other upstream 98636 20083145 ~ 20083618 (-) True G2162127
TU2471773 other upstream 103721 20088230 ~ 20093660 (-) True LOC110509788
TU2472094 other upstream 324680 20309189 ~ 20309802 (-) False G2162405
TU2472087 other upstream 324736 20309245 ~ 20309802 (-) True G2162405

Expression Profile


TU2471631 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

TU2471631 Expression in each Bioproject

Bar chart with 19 bars.
TU2471631 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.