RNA id: TU2503988



Basic Information


Item Value
RNA id TU2503988
length 330
lncRNA type intronic
GC content 0.48
exon number 1
gene id G2189537
representative True

Chromosome Information


Item Value
chromosome id NC_048593.1
NCBI id CM023247.2
chromosome length 47748341
location 47172741 ~ 47173070 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CCAGGCCACAGAGAGTCTATACTAATGGTACCATGCCAGGCAGGCCACAGAGAGTCTATACTAATGGTACCATGTCAGACAGGCCACAGAGAGTCTATACTAATGATACCATGTCAGACCGCTTACTGCCAGGCCACAGAGAGTCTATACTAATGGTACCATGTCAGACAGGCCACAGAGAGTCTATACTAATGGTACCATGTCAGACAGGCCACAGAGAGTCTATACTAATGGTACCATGTCAGACAGGCCACAGAGAGTCTATACTAATGGTACCATGTCAGACAGGCCACAGAGAGTTGATACTAATGGTACCATGTCAGACAGGCC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU2503986 lncRNA upstream 2254 47169230 ~ 47170487 (+) True G2189535
TU2503981 lncRNA upstream 2588 47169230 ~ 47170153 (+) False G2189535
TU2503982 lncRNA upstream 2588 47169230 ~ 47170153 (+) False G2189535
TU2503984 lncRNA upstream 2588 47169230 ~ 47170153 (+) False G2189535
TU2503985 lncRNA upstream 2588 47169230 ~ 47170153 (+) False G2189535
TU2503989 lncRNA downstream 478 47173548 ~ 47173837 (+) True G2189538
TU2503950 lncRNA downstream 5298 47178368 ~ 47179384 (+) True polq
TU2503994 lncRNA downstream 15203 47188273 ~ 47190605 (+) True G2189542
TU2503997 lncRNA downstream 23849 47196919 ~ 47199751 (+) False G2189544
TU2503999 lncRNA downstream 23849 47196919 ~ 47199035 (+) True G2189544
XM_021591699.2 mRNA upstream 284207 46863262 ~ 46888534 (+) False LOC110510302
XM_021591700.2 mRNA upstream 284207 46863262 ~ 46888534 (+) False LOC110510302
XM_021591701.2 mRNA upstream 284207 46863262 ~ 46888534 (+) False LOC110510302
XM_036967787.1 mRNA upstream 284207 46863262 ~ 46888534 (+) True LOC110510302
XM_036968127.1 mRNA upstream 537021 46588208 ~ 46635720 (+) False inpp5kb
XM_036968033.1 mRNA downstream 69935 47243005 ~ 47270503 (+) True c1qa
XM_036967927.1 mRNA downstream 107027 47280097 ~ 47287013 (+) False c1qc
XM_036967928.1 mRNA downstream 107044 47280114 ~ 47287013 (+) True c1qc
XM_036967905.1 mRNA downstream 130968 47304038 ~ 47314715 (+) True c1qb
XM_036968268.1 mRNA downstream 170489 47343559 ~ 47359320 (+) False hoatz
TU2503979 other upstream 7215 47165061 ~ 47165526 (+) True G2189534
TU2503954 other upstream 21089 47148558 ~ 47151652 (+) False polq
TU2503678 other upstream 95268 47070742 ~ 47077473 (+) False G2189323
TU2503949 other downstream 14485 47187555 ~ 47224353 (+) True G2189507
TU2504200 other downstream 392179 47565249 ~ 47567756 (+) True G2189691
TU2504219 other downstream 454232 47627302 ~ 47634567 (+) False G2189694

Expression Profile


TU2503988 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

TU2503988 Expression in each Bioproject

Bar chart with 15 bars.
TU2503988 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.