RNA id: TU2521869



Basic Information


Item Value
RNA id TU2521869
length 501
RNA type TUCP
GC content 0.34
exon number 5
gene id G2204181
representative False

Chromosome Information


Item Value
chromosome id NC_050570.1
NCBI id CM025857.1
chromosome length 46327593
location 14627094 ~ 14629178 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ATGCAGTAATATTCAAAACATAATACTAATATGCCACTTGGATGACAGTAGGTTTGTTGCATTAACATTACTTTACTGGAAAGCTTTATGACTTGCAATGGTGACACAACTACGCCAAAAAGCACAATCTATACTACGCCAAAAAGCACAATCTATACTACGTCAAAAAGCACAATCTATACTACGTCAAAAATCACAATCTATACTACGTCAAAAAGCACAATCTATACTACGTCAAAAAGCACAATCTATACTACGCCAAAAAGCACAATCTATACTACGTCAAAAAACACAATCTATACTACGTCAAAAAACACAATCTATACTACGCCAAAAAGCACAATCTATACTACGTCAAAAAACACAATCTATACTACGCCAAAAAACACAATCTATACTACGTCAAAAAGCACAATCTATACTACGCCAATAAGCACAATCTATACTACGTCAAAAAACACAATCTATACTACGTCAAAAAACACAATCTATACTACGCCA

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU2521789 lncRNA downstream 63824 14561924 ~ 14563270 (-) True LOC110517476
TU2521788 lncRNA downstream 69136 14556785 ~ 14557958 (-) True G2204112
TU2521829 lncRNA downstream 73808 14552739 ~ 14553286 (-) True G2204148
TU2521827 lncRNA downstream 74557 14552289 ~ 14552537 (-) True G2204147
TU2521812 lncRNA downstream 91778 14534953 ~ 14535316 (-) True G2204133
TU2521920 lncRNA upstream 49185 14678363 ~ 14678578 (-) True G2204213
TU2521921 lncRNA upstream 56321 14685499 ~ 14685740 (-) True G2204214
TU2521923 lncRNA upstream 59178 14688356 ~ 14688583 (-) True G2204216
TU2521947 lncRNA upstream 105634 14734812 ~ 14736224 (-) True G2204239
TU2521954 lncRNA upstream 111370 14740548 ~ 14742416 (-) False LOC110521392
XM_036969228.1 mRNA downstream 9583 14561897 ~ 14617511 (-) False LOC110517476
XM_036969229.1 mRNA downstream 9583 14561897 ~ 14617511 (-) False LOC110517476
XM_036969227.1 mRNA downstream 11735 14561897 ~ 14615359 (-) False LOC110517476
XR_002473057.2 mRNA downstream 193404 14432004 ~ 14433690 (-) True LOC110520943
XM_021598919.2 mRNA downstream 267810 14301881 ~ 14359284 (-) False LOC110521389
XR_002473131.2 mRNA upstream 115623 14744801 ~ 14746591 (-) False LOC110521392
XM_036969009.1 mRNA upstream 255658 14884836 ~ 15161793 (-) True LOC110522744
XM_036969168.1 mRNA upstream 554048 15183226 ~ 15195646 (-) False LOC110521403
XM_021598933.2 mRNA upstream 554048 15183226 ~ 15196176 (-) False LOC110521403
XR_005040940.1 mRNA upstream 561680 15190858 ~ 15196179 (-) True LOC110521403
TU2521808 other downstream 101626 14524964 ~ 14525468 (-) True G2204129
TU2520927 other downstream 382632 14174441 ~ 14244462 (-) True G2203363
TU2520586 other downstream 614582 14011153 ~ 14012512 (-) True G2203060
TU2520518 other downstream 729396 13862504 ~ 13897698 (-) True si:ch211-106e7.2
TU2520391 other downstream 956114 13667214 ~ 13670980 (-) True urahb
TU2522053 other upstream 261757 14890935 ~ 14893501 (-) True G2204315
TU2522307 other upstream 715845 15345023 ~ 15376426 (-) True LOC110521406
TU2523306 other upstream 1520955 16150133 ~ 16150537 (-) True G2205496
TU2523580 other upstream 1654310 16283488 ~ 16283932 (-) True G2205743
TU2523638 other upstream 1748799 16377977 ~ 16379668 (-) True LOC110521421

Expression Profile


TU2521869 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU2521869 Expression in each Bioproject

Bar chart with 2 bars.
TU2521869 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.