RNA id: TU2570596



Basic Information


Item Value
RNA id TU2570596
length 358
lncRNA type inter_gene
GC content 0.58
exon number 1
gene id G2247806
representative True

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 7237724 ~ 7238081 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gaaaagggtgtttagccccctcaagccaatgcctccacaccttcaaggcttctacgacagctaacagctctcggttccccacatcatagtttcgctccgccgggctgagcttcttcgaaaagaaagcacaggggcgaagcttcagtggcgtacccgaacgctgagagagcactgctcctatcccagcttcggatgcgtccacctccactatgaatggcaaagagggatccggatgagccaacacaggcaccgaggtaaacagagtcttcaggtgcccaaaagccctgttcgcctcagccgaccactgcaagcgcaccgggcccccctttagcagtgaggtaatgggagcagccacctg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU2570591 lncRNA downstream 12777 7224226 ~ 7224947 (-) True G2247801
TU2570589 lncRNA downstream 21875 7209516 ~ 7215849 (-) True G2247799
TU2570576 lncRNA downstream 96372 7140527 ~ 7141352 (-) True G2247793
TU2570550 lncRNA downstream 132402 7105093 ~ 7105322 (-) True G2247775
TU2570409 lncRNA downstream 147759 7089060 ~ 7089965 (-) True G2247657
TU2570606 lncRNA upstream 20607 7258688 ~ 7258920 (-) True G2247816
TU2570611 lncRNA upstream 27132 7265213 ~ 7265524 (-) True G2247821
TU2570823 lncRNA upstream 57927 7296008 ~ 7296299 (-) True G2247986
TU2570827 lncRNA upstream 76970 7315051 ~ 7315250 (-) True G2247989
TU2570828 lncRNA upstream 79917 7317998 ~ 7318222 (-) True G2247990
XM_021583258.2 mRNA downstream 36224 7127869 ~ 7201500 (-) True LOC110504506
XM_021583259.1 mRNA downstream 98764 7127869 ~ 7138960 (-) False LOC110504506
XM_021583260.2 mRNA downstream 106171 7127869 ~ 7131553 (-) False LOC110504506
XM_036970557.1 mRNA downstream 815295 6116114 ~ 6422429 (-) False LOC110504499
XM_036969849.1 mRNA upstream 460102 7698183 ~ 7708261 (-) False LOC110504480
XM_036969850.1 mRNA upstream 460102 7698183 ~ 7725792 (-) True LOC110504480
XR_005041150.1 mRNA upstream 597162 7835243 ~ 7849870 (-) False LOC110504483
XM_036970504.1 mRNA upstream 620044 7858125 ~ 7871074 (-) False LOC110504356
XM_036970505.1 mRNA upstream 620044 7858125 ~ 7871074 (-) False LOC110504356
TU2570306 other downstream 213185 6938623 ~ 7024539 (-) False G2247565
TU2570303 other downstream 213185 6948120 ~ 7024539 (-) True G2247565
TU2570139 other downstream 366624 6870587 ~ 6871100 (-) True G2247416
TU2568862 other downstream 1385125 5848119 ~ 5852599 (-) True G2246314
TU2568854 other downstream 1385522 5848119 ~ 5852202 (-) False G2246314
TU2570603 other upstream 17263 7255344 ~ 7255940 (-) True G2247813
TU2571450 other upstream 802795 8040876 ~ 8041480 (-) True G2248522
TU2571633 other upstream 915830 8153911 ~ 8157533 (-) False G2248668
TU2571635 other upstream 915830 8153911 ~ 8157533 (-) False G2248668
TU2572664 other upstream 1908710 9146791 ~ 9148302 (-) True c1qtnf2

Expression Profile


TU2570596 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

TU2570596 Expression in each Bioproject

Bar chart with 20 bars.
TU2570596 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.