RNA id: TU2571450



Basic Information


Item Value
RNA id TU2571450
length 605
RNA type TUCP
GC content 0.37
exon number 1
gene id G2248522
representative True

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 8040876 ~ 8041480 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cagatgtccttctcttcttcttctaccacattatggaacaacatattcagatgtccttctcttcttcttctaccacattatggaacaacatattcagatgtccttctcttcttctaccacattatggaacaacatattcagatgtccttctcttcttctaccacattatggaacaacatattcagatgtccttctcttcttcttctaccacattatggaacaacatattcagatgtccttctcttcttctaccacattatggaacaacatattcagatgtccttctcttcttcttctaccacattatggaacaacatattcagatgcccttctcttcttctaccacattatggaacaacatattcagatgtccttctcttcttcttctaccacattatggaacaacatattcagatgtccttctcttcttctaccacattatggaacaacatattcagatgtccttctcttcttcttctaccacattatggaacaacatattcagatgtccttctcttcttcttctaccacattatggaacaacatattcagatgtccttctcttcttctaccacattatggaacaacatattcagatgtccttc

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU2571449 lncRNA downstream 1227 8039444 ~ 8039649 (-) True G2248521
TU2571447 lncRNA downstream 1592 8039044 ~ 8039284 (-) True G2248519
TU2571440 lncRNA downstream 4657 8036008 ~ 8036219 (-) True G2248514
TU2571433 lncRNA downstream 15965 8022320 ~ 8024911 (-) True G2248510
TU2571420 lncRNA downstream 24351 8013360 ~ 8016525 (-) True G2248500
TU2571694 lncRNA upstream 108067 8149547 ~ 8149918 (-) True G2248708
TU2571693 lncRNA upstream 108831 8150311 ~ 8151684 (-) True G2248707
TU2571696 lncRNA upstream 111897 8153377 ~ 8153688 (-) True G2248710
TU2571641 lncRNA upstream 115138 8156618 ~ 8157533 (-) False G2248668
TU2571642 lncRNA upstream 115138 8156618 ~ 8157533 (-) False G2248668
XM_036969871.1 mRNA downstream 114117 7896711 ~ 7926759 (-) False LOC110504485
XM_036969872.1 mRNA downstream 114117 7896711 ~ 7926759 (-) True LOC110504485
XM_036970509.1 mRNA downstream 148698 7871894 ~ 7892178 (-) False LOC110504484
XM_036970510.1 mRNA downstream 148698 7871894 ~ 7892178 (-) True LOC110504484
XM_036970507.1 mRNA downstream 151740 7871894 ~ 7889136 (-) False LOC110504484
XM_021583263.2 mRNA upstream 49554 8091034 ~ 8104745 (-) True LOC110504508
XM_021583273.2 mRNA upstream 131741 8173221 ~ 8224552 (-) False LOC110504516
XM_036970233.1 mRNA upstream 208052 8249532 ~ 8264238 (-) False LOC110504517
XM_036970234.1 mRNA upstream 208052 8249532 ~ 8264238 (-) False LOC110504517
XM_036970235.1 mRNA upstream 208052 8249532 ~ 8264238 (-) False LOC110504517
TU2570603 other downstream 784936 7255344 ~ 7255940 (-) True G2247813
TU2570306 other downstream 1016337 6938623 ~ 7024539 (-) False G2247565
TU2570303 other downstream 1016337 6948120 ~ 7024539 (-) True G2247565
TU2570139 other downstream 1169776 6870587 ~ 6871100 (-) True G2247416
TU2568862 other downstream 2188277 5848119 ~ 5852599 (-) True G2246314
TU2571633 other upstream 112431 8153911 ~ 8157533 (-) False G2248668
TU2571635 other upstream 112431 8153911 ~ 8157533 (-) False G2248668
TU2572664 other upstream 1105311 9146791 ~ 9148302 (-) True c1qtnf2
TU2572681 other upstream 1108408 9149888 ~ 9150141 (-) True G2249506
TU2573640 other upstream 1910837 9952317 ~ 9952703 (-) True G2250247

Expression Profile


TU2571450 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU2571450 Expression in each Bioproject

Bar chart with 7 bars.
TU2571450 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.