RNA id: TU2582168



Basic Information


Item Value
RNA id TU2582168
length 606
lncRNA type inter_gene
GC content 0.33
exon number 3
gene id G2257341
representative True

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 16553913 ~ 16558524 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


TACATCATGTTGTTACTTTTTGATCTAGCTTTTTGCTAATTTTCAAAACAGATTGTGTATCACTTATTATGGCAATAAAATCATGGTGATTATCTGAATGATAGAATATGACTAAAAGGCACAGTGATTATCTGAATGAAACAGTATGACTAAAGGGCATGGTGATTATCTGAATGAAAGAATATGACTAAAGGGCATGGTGATTATCTGAATGTAAGAATATGACTAAAGGGCATGGTGATTATCTGAATGATAGAATATGACTAAAGGGCATGGTGATTATCTGAATGAAAGAATATGACTAAAGGGCATGGTGATTATCTGAATGAAAGAGTATGACTAAAGGGCATGGTGATTATCTGAATGAAAGAATATGACTAAAGGGCATGGTGATTATCTGAATGAAAGAGTATGACTAAAGGGCACAGTGATTATCTGAATGATAGAATATGACTAAAGGGCATGGTGATTATCTGAATGATAGAATATGACTAAAAGGCACAGTGATTATCTGAATGAAACAGTATGACTAAAGGGCATGGTGATTATCTGAATGAAAGAGTATGACTAAAGGACATGGTGATTATCTGAATGATAGAATATGAC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU2582088 lncRNA downstream 2336 16459864 ~ 16552125 (-) True LOC110504669
TU2582103 lncRNA downstream 9273 16542126 ~ 16545188 (-) True G2257282
TU2582092 lncRNA downstream 14104 16538449 ~ 16540357 (-) True G2257271
TU2582160 lncRNA downstream 39093 16509356 ~ 16515368 (-) True G2257337
TU2582146 lncRNA downstream 74406 16479569 ~ 16480055 (-) True G2257323
TU2582102 lncRNA upstream 86114 16644638 ~ 16646013 (-) True G2257281
TU2582233 lncRNA upstream 94313 16652837 ~ 16703581 (-) True G2257375
TU2582282 lncRNA upstream 142224 16700748 ~ 16701181 (-) True G2257409
TU2582263 lncRNA upstream 160997 16719521 ~ 16819520 (-) False LOC110504653
TU2582262 lncRNA upstream 164375 16722899 ~ 16819520 (-) False LOC110504653
XM_021583440.2 mRNA downstream 2285 16548480 ~ 16552176 (-) False LOC110504669
XM_036970267.1 mRNA downstream 36387 16501304 ~ 16518074 (-) True LOC110504680
XM_021583452.2 mRNA downstream 36992 16501304 ~ 16517469 (-) False LOC110504680
XM_021583439.2 mRNA downstream 111185 16437786 ~ 16443276 (-) True LOC110504667
XM_036970027.1 mRNA downstream 120727 16376297 ~ 16433734 (-) True LOC110504639
XM_036970254.1 mRNA upstream 40016 16598540 ~ 16600846 (-) False LOC110504676
XM_021583449.2 mRNA upstream 40016 16598540 ~ 16600886 (-) True LOC110504676
XM_036969962.1 mRNA upstream 58376 16616900 ~ 16619627 (-) False nudt22
XM_021583437.2 mRNA upstream 58376 16616900 ~ 16620090 (-) False nudt22
XM_021583438.2 mRNA upstream 58376 16616900 ~ 16620652 (-) True nudt22
TU2580364 other downstream 911341 15627780 ~ 15643120 (-) True LOC110504385
TU2579781 other downstream 1280853 15272878 ~ 15273608 (-) True G2255363
TU2579570 other downstream 1443828 15110233 ~ 15110633 (-) True G2255168
TU2578473 other downstream 2454704 14099389 ~ 14099757 (-) True G2254275
TU2577997 other downstream 2713772 13798351 ~ 13840689 (-) True G2253906
TU2582255 other upstream 180044 16738568 ~ 16819520 (-) False LOC110504653
TU2582261 other upstream 180044 16738568 ~ 16819520 (-) False LOC110504653
TU2582391 other upstream 417075 16975599 ~ 16990836 (-) True LOC110504656
TU2582386 other upstream 496514 17055038 ~ 17061455 (-) True LOC110504684
TU2582582 other upstream 787362 17345886 ~ 17349631 (-) True G2257651

Expression Profile


TU2582168 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU2582168 Expression in each Bioproject

Bar chart with 16 bars.
TU2582168 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.