RNA id: TU2594662



Basic Information


Item Value
RNA id TU2594662
length 333
lncRNA type intronic
GC content 0.41
exon number 1
gene id G2268147
representative True

Chromosome Information


Item Value
chromosome id NC_050571.1
NCBI id CM025858.1
chromosome length 44108611
location 28388992 ~ 28389324 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GTAAATCTGCTACTCTAGAGGAATCTGGAGGGATATGACACAGGTCACTGCTTCCACATCCGTCAGAGGCTCCGCTAGAAATTTGAATACTTGACACAGTGGTTTCTTCCACACATGGCTGATAGTCACACTTCACTAAATGGATCACATTCACCTCACAGATTCAAGGCAGTTCCTTGATGTGGAAAATATTCAATGCAGAACGACAATAATGAATTATAGGAAACACTATTATTCTACTTTTCTGGGTCTTTTGTTATCTGTAATGTTATCCATTGTACACCATATGGAATGGTAAGTCACGCAGAGCTAAAGACAACATGCCAAAGGCCT

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU2594646 lncRNA upstream 36619 28351818 ~ 28352373 (+) True G2268133
TU2594645 lncRNA upstream 36778 28351818 ~ 28352214 (+) False G2268133
TU2594644 lncRNA upstream 37592 28351197 ~ 28351400 (+) True G2268132
TU2594593 lncRNA upstream 89125 28296173 ~ 28299867 (+) True G2268083
TU2594613 lncRNA upstream 103035 28281171 ~ 28285957 (+) True G2268103
TU2594669 lncRNA downstream 5074 28394398 ~ 28394676 (+) True G2268151
TU2594670 lncRNA downstream 5431 28394755 ~ 28394961 (+) True G2268152
TU2594671 lncRNA downstream 6644 28395968 ~ 28396232 (+) True G2268153
TU2594678 lncRNA downstream 13081 28402405 ~ 28402690 (+) True G2268160
TU2594737 lncRNA downstream 109241 28498565 ~ 28498838 (+) True G2268211
XM_021583808.2 mRNA upstream 18485 28358692 ~ 28370507 (+) False LOC110504931
XM_021583810.2 mRNA upstream 18485 28358692 ~ 28370507 (+) False LOC110504931
XM_036969776.1 mRNA upstream 18485 28358692 ~ 28370507 (+) False LOC110504931
XM_021583811.2 mRNA upstream 18485 28358693 ~ 28370507 (+) True LOC110504931
trnav-uac-98 mRNA upstream 35303 28353617 ~ 28353689 (+) True trnav-uac-98
XR_005041208.1 mRNA downstream 12925 28402249 ~ 28404199 (+) True LOC110504300
XM_021583814.2 mRNA downstream 17694 28407018 ~ 28409839 (+) True LOC110504934
XM_021583815.2 mRNA downstream 20987 28410311 ~ 28425659 (+) False LOC110504935
XM_021583816.2 mRNA downstream 20987 28410311 ~ 28425659 (+) False LOC110504935
XM_036970238.1 mRNA downstream 20987 28410311 ~ 28425659 (+) True LOC110504935
TU2593017 other upstream 1453103 26934720 ~ 26935889 (+) True G2266826
TU2592839 other upstream 1768044 26591266 ~ 26620948 (+) True G2266668
TU2592687 other upstream 2016509 26361992 ~ 26372483 (+) True LOC110504416
TU2592623 other upstream 2097331 26289825 ~ 26291661 (+) False LOC118946064
TU2594875 other downstream 377553 28766877 ~ 28767729 (+) True G2268340
TU2594947 other downstream 507431 28896755 ~ 28898079 (+) True G2268400
TU2597789 other downstream 2787566 31176890 ~ 31181107 (+) True G2271027
TU2599828 other downstream 4474112 32863436 ~ 32863779 (+) False G2272912
TU2600208 other downstream 5026766 33416090 ~ 33421685 (+) True LOC110505056

Expression Profile


TU2594662 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

TU2594662 Expression in each Bioproject

Bar chart with 6 bars.
TU2594662 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.