RNA id: TCONS_00005460


Basic Information

Item Value
RNA id TCONS_00005460
length 115
RNA type miRNA
GC content 0.57
exon number 1
gene id XLOC_002962
representative False

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 38029360 ~ 38168078 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CCCGTGCGGCCACCGCTGCACTCCTCCTGGTCCCTGAGACCCTAACTTGTGAGCTTTGTGTGCTAAAAATCACAGGTTAAGCTCTTGGGACCTGGGCAGAGGGCAAAAGCACTGG

Function

GO:

id name namespace
GO:0031224 intrinsic component of membrane cellular_component
GO:0044425 obsolete membrane part cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000118670

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00006103 lncRNA downstream 25685 37729311 ~ 38025967 (-) False XLOC_002960
TCONS_00006104 lncRNA downstream 25766 37778486 ~ 38025886 (-) False XLOC_002960
TCONS_00005776 lncRNA downstream 25856 38020456 ~ 38025796 (-) True XLOC_002960
TCONS_00005775 lncRNA downstream 162091 37865419 ~ 37889561 (-) True XLOC_002961
TCONS_00006102 lncRNA downstream 563931 37485412 ~ 37487721 (-) True XLOC_002959
TCONS_00005462 lncRNA upstream 21916 38073682 ~ 38168078 (-) False XLOC_002962
TCONS_00006118 lncRNA upstream 261857 38313623 ~ 38316161 (-) True XLOC_002965
TCONS_00006119 lncRNA upstream 361164 38412930 ~ 38430658 (-) False XLOC_002967
TCONS_00006120 lncRNA upstream 361164 38412930 ~ 38431095 (-) False XLOC_002967
TCONS_00006121 lncRNA upstream 460142 38511908 ~ 38515531 (-) False XLOC_002969
TCONS_00005458 mRNA downstream 563974 37485403 ~ 37487678 (-) False XLOC_002959
TCONS_00005455 mRNA downstream 714073 37334270 ~ 37337579 (-) True XLOC_002956
TCONS_00005452 mRNA downstream 976291 36950773 ~ 37075361 (-) False XLOC_002954
TCONS_00005453 mRNA downstream 978876 36953619 ~ 37072776 (-) True XLOC_002954
TCONS_00005451 mRNA downstream 1124058 36828069 ~ 36927594 (-) True XLOC_002953
TCONS_00005464 mRNA upstream 116392 38168158 ~ 38243851 (-) False XLOC_002964
TCONS_00005465 mRNA upstream 119275 38171041 ~ 38243579 (-) True XLOC_002964
TCONS_00005466 mRNA upstream 204790 38256556 ~ 38316134 (-) False XLOC_002965
TCONS_00005469 mRNA upstream 378593 38430359 ~ 38456382 (-) False XLOC_002967
TCONS_00005470 mRNA upstream 378593 38430359 ~ 38498072 (-) False XLOC_002967
TCONS_00005456 other downstream 694349 37352480 ~ 37357303 (-) True XLOC_002957
TCONS_00005438 other downstream 1369138 36681652 ~ 36682514 (-) True XLOC_002946
TCONS_00005427 other downstream 1549321 36487618 ~ 36502331 (-) True XLOC_002940
TCONS_00005410 other downstream 1888358 36163179 ~ 36163294 (-) True XLOC_002926
TCONS_00005408 other downstream 2397298 35654245 ~ 35654354 (-) True XLOC_002923
TCONS_00005461 other upstream 20311 38072077 ~ 38072168 (-) True XLOC_002963
TCONS_00005463 other upstream 22546 38074312 ~ 38074391 (-) True XLOC_002962
TCONS_00005467 other upstream 239121 38290887 ~ 38316070 (-) False XLOC_002965
TCONS_00005468 other upstream 324368 38376134 ~ 38376253 (-) True XLOC_002966
TCONS_00005472 other upstream 382617 38434383 ~ 38434499 (-) True XLOC_002968

Expression Profile

//