RNA id: TCONS_00058968


Basic Information

Item Value
RNA id TCONS_00058968
length 847
RNA type mRNA
GC content 0.43
exon number 6
gene id XLOC_030156
representative False

Chromosome Information

Item Value
chromosome id NC_007116.7
NCBI id CM002889.2
chromosome length 72500376
location 29820266 ~ 29825846 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCTTTCCTAATGTGCAGTTGGAGCTTCTAACCAGTTTCAGATAAGTTTCTGCTTATCTTCACTCAGTTTTGTGCGGACCTAGCAAATAAACAGCTGCAACACGGTTCTGCTAAAATAATATACTTTCGGGTAACATTTGAAACGCATACCGTAGAAAACCTTCTATCATTTCAGACTGGAAATGTTGACTTTAGTCTTTGTGTGTCTCTCTTTTTCACTCACAGGCCTACATGCTTCCTTTTCAGTGGCTGTTAATGGTCCCATAGTAAAAGTGAAGGAGAATGAGGGAGTTGACTTGCAATGTTCCTACACCGCTGACTTTGGAGCAACACCCAGAGTAGAATGGAAGTTCAGAAATCTGAAGGGCTTTCAGTATTTCATCTACTTTAATAACAAACCAACTGTTGAATATGAACAGCGCATCACTGTGTACGCTGGAGGACTGAGATTTCAAAAAGTAACGCGAGCAGACGCTGGAGATTATAACTGTGAGGTTTCTGGAAACGGTGGATATGGAGAGAATACCATCAAACTTGTAGTCTCTGTTCCTCCTTCCAAGCCTGTATCCAGCATTCCTTCATCAGTCACAACAGGCAGTAACGTCCGCCTGACTTGCTTTGACCCAGTTGGCTCTCCTCCATCCACCTATGAGTGGTACAAAGACAACAACCTCCTCCCTGAGGACCCAACCAAGTTTCCCATTTTTAAGAACCTCACATATAAGATGAATGCTTTCAATGGAAACCTGGAGTTCTTGAGTGTGTCTAAGTGGGATGCTGGCTCATATTTTTGTGTGGCCAGTAATGAAAACGGTGTCTCTCAGCATGGTGATGCAGTGAAGATGGAA

Function

GO:

id name namespace
GO:0050892 intestinal absorption biological_process
GO:0090557 establishment of endothelial intestinal barrier biological_process
GO:0090559 regulation of membrane permeability biological_process
GO:0007155 cell adhesion biological_process
GO:0005923 bicellular tight junction cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-060531-67 Predicted to be involved in establishment of endothelial intestinal barrier; intestinal absorption; and regulation of membrane permeability. Predicted to act upstream of or within cell adhesion. Predicted to be located in cell junction and plasma membrane. Predicted to be integral component of membrane. Predicted to be active in bicellular tight junction. Is expressed in several structures, including immature eye; integument; otic vesicle; pronephric duct; and sensory system. Human ortholog(s) of this gene implicated in hypertension. Orthologous to human F11R (F11 receptor).

Ensembl:

ensembl_id ENSDART00000146331

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00058959 lncRNA upstream 27642 29784172 ~ 29792624 (+) True XLOC_030153
TCONS_00061714 lncRNA upstream 254441 29560655 ~ 29565825 (+) False XLOC_030150
TCONS_00061715 lncRNA upstream 254441 29562648 ~ 29565825 (+) True XLOC_030150
TCONS_00061713 lncRNA upstream 257769 29560059 ~ 29562497 (+) False XLOC_030150
TCONS_00061712 lncRNA upstream 577106 29241794 ~ 29243160 (+) True XLOC_030149
TCONS_00061717 lncRNA downstream 78913 29902153 ~ 29952916 (+) False XLOC_030159
TCONS_00061716 lncRNA downstream 78913 29902153 ~ 29952916 (+) False XLOC_030159
TCONS_00061719 lncRNA downstream 78913 29902153 ~ 29988431 (+) False XLOC_030159
TCONS_00061718 lncRNA downstream 78913 29902153 ~ 29988431 (+) False XLOC_030159
TCONS_00061438 lncRNA downstream 78921 29902161 ~ 29902869 (+) False XLOC_030159
TCONS_00058962 mRNA upstream 2418 29803380 ~ 29817848 (+) False XLOC_030155
TCONS_00058964 mRNA upstream 7676 29803422 ~ 29812590 (+) False XLOC_030155
TCONS_00058965 mRNA upstream 7955 29803428 ~ 29812311 (+) False XLOC_030155
TCONS_00058967 mRNA upstream 7955 29803702 ~ 29812311 (+) True XLOC_030155
TCONS_00058966 mRNA upstream 8298 29803530 ~ 29811968 (+) False XLOC_030155
TCONS_00058971 mRNA downstream 7995 29831235 ~ 29848772 (+) False XLOC_030157
TCONS_00058973 mRNA downstream 28193 29851433 ~ 29896768 (+) True XLOC_030158
TCONS_00058977 mRNA downstream 266475 30089715 ~ 30090506 (+) True XLOC_030163
TCONS_00058979 mRNA downstream 355770 30179010 ~ 30209068 (+) True XLOC_030165
TCONS_00058980 mRNA downstream 561314 30384554 ~ 30391820 (+) True XLOC_030166
TCONS_00058963 other upstream 7654 29803411 ~ 29812612 (+) False XLOC_030155
TCONS_00058961 other upstream 21208 29794076 ~ 29799058 (+) True XLOC_030154
TCONS_00058952 other upstream 605620 29214530 ~ 29214646 (+) True XLOC_030148
TCONS_00058939 other upstream 994126 28824612 ~ 28826140 (+) True XLOC_030141
TCONS_00058938 other upstream 1001653 28812453 ~ 28818613 (+) True XLOC_030140
TCONS_00058970 other downstream 7955 29831195 ~ 29847899 (+) False XLOC_030157
TCONS_00058972 other downstream 8165 29831405 ~ 29843117 (+) True XLOC_030157
TCONS_00058974 other downstream 166907 29990147 ~ 29990221 (+) True XLOC_030160
TCONS_00058975 other downstream 167212 29990452 ~ 29990544 (+) True XLOC_030161
TCONS_00058976 other downstream 175522 29998762 ~ 29998847 (+) True XLOC_030162

Expression Profile

//