RNA id: TU2678913


Basic Information

Item Value
RNA id TU2678913
length 520
lncRNA type sense_over
GC content 0.44
exon number 2
gene id LOC118947133
representative True

Chromosome Information

Item Value
chromosome id NW_023493665.1
NCBI id JAAXML020000242.1
chromosome length 1484196
location 687696 ~ 688516 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence

TCCCGGTTGGGTTGTAACTGTAGAAGTCAGTCCCGGTCCCGGTCAGGTTGGGTTGTAACTGTAGAAGTCAGTCCCGGTTCCGGTCAGGTCGGGTAATAGCTGTAGAAGTCAGTCCCAGTCCTGGTCAGGTTGGGTTGTAACTGTAGAAGTCAGTCCCGGTCCGGTTGTAGAAGTCAGTCCCGGTCCTGGTCAGGTTGGGAGGGGTGTCAGTGCTGTTACTCTGAAGGTATTGCACTTGTCCCGGCCTGTTTAGGATTGAGGAGATGGTGCTCCTACTCTTTAAACCTGCTAAAGCAGTTGGTTGCGTGTTTGAAATGATTGAATGAAACATATATTTACCAAAAAATGAGACTTGTATGTTTTCTGTCCCATGATTCTGTTTTTCTAGATTTGTCTTTAATTAATGAAGAGGTAGTTTTCTAAATTGTAGATGGATTGTCGGAGCTTAAATGTGTCCGTCCATATGGTGAGTACTTGTTTCATGCTGTGGTTTTGTTTCAAATAAAGTTTCCATGTAAAT

Function

GO: NA

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU2678904 lncRNA downstream 5558 680848 ~ 682141 (-) True G2339796
TU2678897 lncRNA downstream 7199 679090 ~ 680500 (-) False G2339792
TU2678899 lncRNA downstream 7199 679819 ~ 680500 (-) False G2339792
TU2678898 lncRNA downstream 7199 680079 ~ 680500 (-) True G2339792
TU2678895 lncRNA downstream 9049 678319 ~ 678650 (-) True G2339790
TU2678918 lncRNA upstream 471 688959 ~ 690289 (-) True G2339806
TU2678934 lncRNA upstream 15457 703945 ~ 704442 (-) True G2339821
TU2678958 lncRNA upstream 32752 721240 ~ 722512 (-) False G2339841
TU2678959 lncRNA upstream 32752 721240 ~ 721893 (-) True G2339841
TU2678963 lncRNA upstream 43348 731836 ~ 732286 (-) True G2339845
XM_036972358.1 mRNA downstream 10844 370255 ~ 676855 (-) False gpc5a
XM_036972376.1 mRNA upstream 18062 706550 ~ 724423 (-) True LOC118947134
XM_036972346.1 mRNA upstream 86194 774682 ~ 796264 (-) False LOC110495337
XM_036972345.1 mRNA upstream 86194 774682 ~ 796453 (-) False LOC110495337
XM_036972344.1 mRNA upstream 86194 774682 ~ 796466 (-) False LOC110495337
XM_036972343.1 mRNA upstream 86194 774682 ~ 796646 (-) False LOC110495337
TU2678597 other downstream 647021 40278 ~ 40678 (-) True G2339563
TU2679242 other upstream 130147 818635 ~ 821681 (-) False txnl4b
TU2679244 other upstream 130147 818635 ~ 832987 (-) False txnl4b
TU2679246 other upstream 130147 818635 ~ 821681 (-) False txnl4b
TU2679247 other upstream 130147 818635 ~ 821681 (-) True txnl4b
TU2679680 other upstream 470471 1158959 ~ 1159747 (-) False ercc5

Expression Profile

TU2678913 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

TU2678913 Expression in each Bioproject

Bar chart with 20 bars.
TU2678913 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
zebrafish (Danio rerio) TCONS_00003306 False 1893 lncRNA 0.40 2 NC_007112.7 3296607 ~ 3299853 (-)